ID: 1060920198

View in Genome Browser
Species Human (GRCh38)
Location 9:127415039-127415061
Sequence TCCCCTCCTCACACCCGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920193_1060920198 3 Left 1060920193 9:127415013-127415035 CCCAACCCTATAATCCTTCTATC No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920196_1060920198 -3 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920192_1060920198 4 Left 1060920192 9:127415012-127415034 CCCCAACCCTATAATCCTTCTAT No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920187_1060920198 28 Left 1060920187 9:127414988-127415010 CCCAATTCTTCCTCAGCCTCCGC No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920191_1060920198 9 Left 1060920191 9:127415007-127415029 CCGCTCCCCAACCCTATAATCCT No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920188_1060920198 27 Left 1060920188 9:127414989-127415011 CCAATTCTTCCTCAGCCTCCGCT No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920190_1060920198 12 Left 1060920190 9:127415004-127415026 CCTCCGCTCCCCAACCCTATAAT No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920194_1060920198 2 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920195_1060920198 -2 Left 1060920195 9:127415018-127415040 CCCTATAATCCTTCTATCATCTC No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data
1060920189_1060920198 18 Left 1060920189 9:127414998-127415020 CCTCAGCCTCCGCTCCCCAACCC No data
Right 1060920198 9:127415039-127415061 TCCCCTCCTCACACCCGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920198 Original CRISPR TCCCCTCCTCACACCCGCTC TGG Intergenic