ID: 1060920200

View in Genome Browser
Species Human (GRCh38)
Location 9:127415041-127415063
Sequence AGCCAGAGCGGGTGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920200_1060920210 -1 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920200_1060920209 -10 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920200_1060920213 16 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920213 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data
1060920200_1060920214 17 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920200_1060920211 3 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920200 Original CRISPR AGCCAGAGCGGGTGTGAGGA GGG (reversed) Intergenic