ID: 1060920201

View in Genome Browser
Species Human (GRCh38)
Location 9:127415042-127415064
Sequence AAGCCAGAGCGGGTGTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920201_1060920210 -2 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920201_1060920213 15 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920213 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data
1060920201_1060920211 2 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920201_1060920214 16 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920201 Original CRISPR AAGCCAGAGCGGGTGTGAGG AGG (reversed) Intergenic