ID: 1060920202

View in Genome Browser
Species Human (GRCh38)
Location 9:127415045-127415067
Sequence TGTAAGCCAGAGCGGGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920202_1060920210 -5 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920202_1060920215 28 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data
1060920202_1060920211 -1 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920202_1060920214 13 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920202_1060920213 12 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920213 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920202 Original CRISPR TGTAAGCCAGAGCGGGTGTG AGG (reversed) Intergenic