ID: 1060920207

View in Genome Browser
Species Human (GRCh38)
Location 9:127415052-127415074
Sequence TTCCCCCTGTAAGCCAGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920207_1060920214 6 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920207_1060920213 5 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920213 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data
1060920207_1060920211 -8 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920207_1060920215 21 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920207 Original CRISPR TTCCCCCTGTAAGCCAGAGC GGG (reversed) Intergenic