ID: 1060920208

View in Genome Browser
Species Human (GRCh38)
Location 9:127415053-127415075
Sequence CTTCCCCCTGTAAGCCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920208_1060920216 30 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920216 9:127415106-127415128 AATGTCTTAAAGGAAATGAGAGG No data
1060920208_1060920215 20 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data
1060920208_1060920214 5 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920208_1060920213 4 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920213 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data
1060920208_1060920211 -9 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920208 Original CRISPR CTTCCCCCTGTAAGCCAGAG CGG (reversed) Intergenic