ID: 1060920209

View in Genome Browser
Species Human (GRCh38)
Location 9:127415054-127415076
Sequence CGCTCTGGCTTACAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920190_1060920209 27 Left 1060920190 9:127415004-127415026 CCTCCGCTCCCCAACCCTATAAT No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920196_1060920209 12 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920195_1060920209 13 Left 1060920195 9:127415018-127415040 CCCTATAATCCTTCTATCATCTC No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920191_1060920209 24 Left 1060920191 9:127415007-127415029 CCGCTCCCCAACCCTATAATCCT No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920197_1060920209 4 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920194_1060920209 17 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920192_1060920209 19 Left 1060920192 9:127415012-127415034 CCCCAACCCTATAATCCTTCTAT No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920199_1060920209 -9 Left 1060920199 9:127415040-127415062 CCCCTCCTCACACCCGCTCTGGC No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920193_1060920209 18 Left 1060920193 9:127415013-127415035 CCCAACCCTATAATCCTTCTATC No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data
1060920200_1060920209 -10 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920209 9:127415054-127415076 CGCTCTGGCTTACAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920209 Original CRISPR CGCTCTGGCTTACAGGGGGA AGG Intergenic