ID: 1060920210

View in Genome Browser
Species Human (GRCh38)
Location 9:127415063-127415085
Sequence TTACAGGGGGAAGGTAGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920200_1060920210 -1 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920202_1060920210 -5 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920197_1060920210 13 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920201_1060920210 -2 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920194_1060920210 26 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920199_1060920210 0 Left 1060920199 9:127415040-127415062 CCCCTCCTCACACCCGCTCTGGC No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920195_1060920210 22 Left 1060920195 9:127415018-127415040 CCCTATAATCCTTCTATCATCTC No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920196_1060920210 21 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920192_1060920210 28 Left 1060920192 9:127415012-127415034 CCCCAACCCTATAATCCTTCTAT No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data
1060920193_1060920210 27 Left 1060920193 9:127415013-127415035 CCCAACCCTATAATCCTTCTATC No data
Right 1060920210 9:127415063-127415085 TTACAGGGGGAAGGTAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920210 Original CRISPR TTACAGGGGGAAGGTAGCCA AGG Intergenic