ID: 1060920211

View in Genome Browser
Species Human (GRCh38)
Location 9:127415067-127415089
Sequence AGGGGGAAGGTAGCCAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920195_1060920211 26 Left 1060920195 9:127415018-127415040 CCCTATAATCCTTCTATCATCTC No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920207_1060920211 -8 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920199_1060920211 4 Left 1060920199 9:127415040-127415062 CCCCTCCTCACACCCGCTCTGGC No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920200_1060920211 3 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920196_1060920211 25 Left 1060920196 9:127415019-127415041 CCTATAATCCTTCTATCATCTCC No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920208_1060920211 -9 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920194_1060920211 30 Left 1060920194 9:127415014-127415036 CCAACCCTATAATCCTTCTATCA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920201_1060920211 2 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920202_1060920211 -1 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data
1060920197_1060920211 17 Left 1060920197 9:127415027-127415049 CCTTCTATCATCTCCCCTCCTCA No data
Right 1060920211 9:127415067-127415089 AGGGGGAAGGTAGCCAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920211 Original CRISPR AGGGGGAAGGTAGCCAAGGA TGG Intergenic