ID: 1060920214

View in Genome Browser
Species Human (GRCh38)
Location 9:127415081-127415103
Sequence CAAGGATGGAGTGAAATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920199_1060920214 18 Left 1060920199 9:127415040-127415062 CCCCTCCTCACACCCGCTCTGGC No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920201_1060920214 16 Left 1060920201 9:127415042-127415064 CCTCCTCACACCCGCTCTGGCTT No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920202_1060920214 13 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920208_1060920214 5 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920207_1060920214 6 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data
1060920200_1060920214 17 Left 1060920200 9:127415041-127415063 CCCTCCTCACACCCGCTCTGGCT No data
Right 1060920214 9:127415081-127415103 CAAGGATGGAGTGAAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920214 Original CRISPR CAAGGATGGAGTGAAATGCA GGG Intergenic