ID: 1060920215

View in Genome Browser
Species Human (GRCh38)
Location 9:127415096-127415118
Sequence ATGCAGGGTAAATGTCTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920212_1060920215 -7 Left 1060920212 9:127415080-127415102 CCAAGGATGGAGTGAAATGCAGG No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data
1060920202_1060920215 28 Left 1060920202 9:127415045-127415067 CCTCACACCCGCTCTGGCTTACA No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data
1060920207_1060920215 21 Left 1060920207 9:127415052-127415074 CCCGCTCTGGCTTACAGGGGGAA No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data
1060920208_1060920215 20 Left 1060920208 9:127415053-127415075 CCGCTCTGGCTTACAGGGGGAAG No data
Right 1060920215 9:127415096-127415118 ATGCAGGGTAAATGTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920215 Original CRISPR ATGCAGGGTAAATGTCTTAA AGG Intergenic