ID: 1060920477

View in Genome Browser
Species Human (GRCh38)
Location 9:127417257-127417279
Sequence TTCTCCAGCCTCTGCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920475_1060920477 -4 Left 1060920475 9:127417238-127417260 CCCAGCTCTGGCTTGGCTGTTCT No data
Right 1060920477 9:127417257-127417279 TTCTCCAGCCTCTGCAAAGCAGG No data
1060920470_1060920477 25 Left 1060920470 9:127417209-127417231 CCAACTGGGGCTTCAGGCCAGAG No data
Right 1060920477 9:127417257-127417279 TTCTCCAGCCTCTGCAAAGCAGG No data
1060920472_1060920477 8 Left 1060920472 9:127417226-127417248 CCAGAGGCTGCTCCCAGCTCTGG No data
Right 1060920477 9:127417257-127417279 TTCTCCAGCCTCTGCAAAGCAGG No data
1060920476_1060920477 -5 Left 1060920476 9:127417239-127417261 CCAGCTCTGGCTTGGCTGTTCTC No data
Right 1060920477 9:127417257-127417279 TTCTCCAGCCTCTGCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920477 Original CRISPR TTCTCCAGCCTCTGCAAAGC AGG Intergenic
No off target data available for this crispr