ID: 1060920905

View in Genome Browser
Species Human (GRCh38)
Location 9:127419647-127419669
Sequence TGCCTTAGCAACTATGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060920897_1060920905 20 Left 1060920897 9:127419604-127419626 CCATTGGTGGACTCTGGTCATCA No data
Right 1060920905 9:127419647-127419669 TGCCTTAGCAACTATGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060920905 Original CRISPR TGCCTTAGCAACTATGGCTG GGG Intergenic
No off target data available for this crispr