ID: 1060925512

View in Genome Browser
Species Human (GRCh38)
Location 9:127452524-127452546
Sequence AGGGCCCGCTAGAGGAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060925512_1060925517 0 Left 1060925512 9:127452524-127452546 CCCTAGCTCCTCTAGCGGGCCCT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1060925517 9:127452547-127452569 GAATCAATGTTGCTTGCATGTGG No data
1060925512_1060925518 1 Left 1060925512 9:127452524-127452546 CCCTAGCTCCTCTAGCGGGCCCT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1060925518 9:127452548-127452570 AATCAATGTTGCTTGCATGTGGG No data
1060925512_1060925519 12 Left 1060925512 9:127452524-127452546 CCCTAGCTCCTCTAGCGGGCCCT 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1060925519 9:127452559-127452581 CTTGCATGTGGGTTGCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060925512 Original CRISPR AGGGCCCGCTAGAGGAGCTA GGG (reversed) Intronic
900937565 1:5776153-5776175 GGGGCCCCATAGAGGAGCTAAGG + Intergenic
902507347 1:16946837-16946859 AGGAACGGCTAGAGGAGCTGCGG + Exonic
902511640 1:16969909-16969931 AGGGCCAGCTACAACAGCTACGG + Exonic
906506039 1:46380302-46380324 AGGGTCTGCTAGAGGGGCTGTGG + Intergenic
912643125 1:111366569-111366591 AGGGCTGGCTACAGCAGCTATGG - Intergenic
915217950 1:154352455-154352477 AGGGTCAGCGAGAGGAGCCAAGG - Intergenic
921357092 1:214295283-214295305 AGGGCCTACAAGAGGAGCTTCGG + Intronic
924771979 1:247087318-247087340 AGGGCCCACCAGAGTAGCTGGGG + Intergenic
1067443624 10:46327137-46327159 AGAGCCCTCAAGAGGAGCGAGGG + Intronic
1070309222 10:75261269-75261291 AGGACAAGCTAGAGGTGCTAGGG - Intergenic
1071805824 10:89119805-89119827 AGGGCCAGCTAAAAGAGCCATGG + Intergenic
1071980531 10:91000530-91000552 AGGGACAGCTACAGCAGCTAGGG + Intergenic
1076525039 10:131107155-131107177 TGGGGCCGTTAGAGAAGCTATGG + Intronic
1077080396 11:722321-722343 AGGGCCAGCCTGTGGAGCTACGG + Intronic
1078138385 11:8671820-8671842 AGGGCTTGATACAGGAGCTAGGG - Exonic
1078810423 11:14756412-14756434 AGGCCCCTCAAGAGGAGCTGTGG + Intronic
1083491723 11:63018984-63019006 AGGCCCCGTTCTAGGAGCTATGG + Intergenic
1089315344 11:117587512-117587534 TGGGCTCCCTAGAGGAGATAGGG - Intronic
1097734206 12:63164342-63164364 AGGACCAGCTAGAATAGCTATGG - Intergenic
1097785458 12:63753925-63753947 AGGGCCAGATGGAGGAGGTATGG - Intergenic
1099159489 12:79223471-79223493 AGGGCCCACTACAGCAGGTATGG + Intronic
1103368187 12:120398266-120398288 AGGGCCCGCCAGAGGAGACTGGG - Intergenic
1104889350 12:132132825-132132847 CGGGGACGCTGGAGGAGCTAGGG + Intergenic
1107537159 13:41346688-41346710 AGGGCCAGATAGAGGAGATATGG + Intronic
1107987935 13:45791975-45791997 AGGGACAGCTGGAGGAGCTATGG - Intronic
1112652663 13:101416154-101416176 AGGGGCTGCTAGAGGGGCTGCGG - Intronic
1117226301 14:53663857-53663879 AGGGCCCCCTTGTGGATCTAAGG - Intergenic
1117554496 14:56870400-56870422 AGGGGCTTCTAGAGGAGGTAAGG - Intergenic
1122158637 14:99766984-99767006 AGGGCCAGCAAGAGGACCTTTGG - Intronic
1126109850 15:45168749-45168771 AGGGCCGGATAAATGAGCTAGGG - Intronic
1126558145 15:50013301-50013323 ATGTCCCCCTAGAAGAGCTATGG - Intronic
1131248313 15:90814772-90814794 AGAGCCTGCAAGAGGAGCTGAGG - Intronic
1132359684 15:101201930-101201952 AGGGCCCACTACAGCAGCTAAGG + Intronic
1143090415 17:4446479-4446501 AGGGCCGGCTATGGGAGGTAAGG + Intronic
1143387763 17:6542146-6542168 AGGGCCCCCATGAGGAGCCAGGG - Intronic
1151731686 17:75915071-75915093 AGCGCGCCCTAGAGGAGCAAAGG - Exonic
1162035717 19:7937651-7937673 AGGGACAGCCAGAGGAGCTCAGG - Intronic
1163142658 19:15360879-15360901 AGGTGCCGCTGGAGGAGCTGCGG + Exonic
929777052 2:44936173-44936195 AGGGCATGCTAGCGGAGCTAGGG + Intergenic
932447782 2:71791335-71791357 TGGGCCAGCAAGGGGAGCTAGGG - Intergenic
940801684 2:158139818-158139840 AGGGCCACCCACAGGAGCTATGG - Intergenic
1172701534 20:36856323-36856345 AGAGGTGGCTAGAGGAGCTATGG - Intronic
1175697505 20:61113665-61113687 AGGGCCCACCATAGGAGCCAGGG + Intergenic
1181972734 22:26704691-26704713 AGGGCCAGCTGGAGGTGCTGGGG + Intergenic
950047052 3:9955030-9955052 AGGGCCCCCTACAGAAGCTGAGG + Intergenic
954964198 3:54596216-54596238 AGGGCCAGCTAGACTAGATATGG - Intronic
961404622 3:126669230-126669252 AGAGCCAGCTAGAGGAGCCTGGG + Intergenic
962198000 3:133380056-133380078 AGGGCCCGCTCCAGCAGCCATGG + Exonic
964135841 3:153344209-153344231 AGTGCCCACTAGAGGAACTGAGG - Intergenic
968537448 4:1143324-1143346 AGCTCCAGCGAGAGGAGCTATGG - Intergenic
973623151 4:52747370-52747392 AGGGCCAGATAGAGGAGGTATGG - Intronic
978583935 4:110258121-110258143 AGGGCCAGATGGAGGAGGTAGGG + Intergenic
982175470 4:152701931-152701953 AGGGCCAGGTAGAGGAGATATGG - Intronic
986615912 5:9617385-9617407 AGGGGCCGCTCTAGGAGCTGGGG - Intergenic
999188263 5:149729027-149729049 AAGGCCTGCTGGTGGAGCTAAGG + Intergenic
1001476925 5:172057219-172057241 AGTGCCCCCAAGAGGAGCCAGGG - Intronic
1002981735 6:2144579-2144601 AGGGCCAGATAGAGGAGGTCTGG + Intronic
1006007615 6:31015169-31015191 TGGGCCAGATAGAGGAGCTATGG + Intronic
1014821229 6:125990427-125990449 AGGGCCCCCCAGAGGAGAAAAGG - Intronic
1015393665 6:132711868-132711890 GGGGCCTGCAAGAGGAGCTGAGG + Intronic
1017984940 6:159435662-159435684 AGAGCCTGCTAGAGGAGACAGGG - Intergenic
1023594228 7:41811831-41811853 AGGGCCTGAGAGAGAAGCTAAGG + Intergenic
1026930683 7:74221519-74221541 ATGGCCCCCAAGAGGAGCAATGG + Intronic
1029382657 7:100223682-100223704 AGGTCCCGCTTGAGCACCTAGGG + Exonic
1032189134 7:129752961-129752983 AGGGCACACCAGAGGAGCCAGGG + Intronic
1034414073 7:150955809-150955831 GGGGCCGGCTGGAGGAGCTGAGG - Intronic
1037834644 8:22208845-22208867 AGGTCTCGCTAGAGGAGGTGGGG - Intronic
1038362880 8:26900517-26900539 AGGGACAGCAAGAGAAGCTAGGG - Intergenic
1045713426 8:105013434-105013456 AGTTCCTGCTAGAGGAGCTTAGG + Intronic
1049270308 8:141692152-141692174 AGGGCCCCTTAGAGGAGCACAGG - Intergenic
1050798588 9:9579589-9579611 AGGGCCTGTTAGAGGAGGTGTGG - Intronic
1051616551 9:19012336-19012358 AGGGACAGTTAGAGGCGCTAGGG + Intronic
1060754314 9:126201351-126201373 ATGACCCACTAGAAGAGCTAAGG + Intergenic
1060925512 9:127452524-127452546 AGGGCCCGCTAGAGGAGCTAGGG - Intronic
1061973938 9:134058973-134058995 AGCGCCTGCTGGAGGAGCCAAGG + Intronic
1185691566 X:2159304-2159326 AGGGCCCCATGGAGGAGCTCAGG - Intergenic
1195255032 X:103082003-103082025 AGGGCACGCTAGAGGAGGCTGGG + Intronic