ID: 1060928700

View in Genome Browser
Species Human (GRCh38)
Location 9:127474123-127474145
Sequence ACAGCTTGTGCTTGGCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060928700_1060928706 28 Left 1060928700 9:127474123-127474145 CCAGCTTGCCAAGCACAAGCTGT 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1060928706 9:127474174-127474196 ACCATGATCCTTCCCTCTTCAGG No data
1060928700_1060928708 29 Left 1060928700 9:127474123-127474145 CCAGCTTGCCAAGCACAAGCTGT 0: 1
1: 0
2: 1
3: 8
4: 151
Right 1060928708 9:127474175-127474197 CCATGATCCTTCCCTCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060928700 Original CRISPR ACAGCTTGTGCTTGGCAAGC TGG (reversed) Intronic
900477625 1:2883376-2883398 CCAGCCTGTGCTTGGCCAGGCGG + Intergenic
901413635 1:9102297-9102319 GCAGCTTGGGATTGGGAAGCAGG + Exonic
901660235 1:10794589-10794611 CCAGCTTCAGCTTGGAAAGCCGG - Intronic
902280604 1:15371562-15371584 ACAGCCTGTGCTTGGCCTGAGGG - Intronic
904524045 1:31119155-31119177 CCAGCTTGGGCTGGGCAAGGTGG + Intergenic
904743330 1:32695359-32695381 AAAGCTTCTGCTTGACCAGCCGG + Exonic
906407260 1:45551905-45551927 ACAGGTTGAGTTTGGCCAGCTGG - Intronic
906530795 1:46522871-46522893 ACAGCATGTGCTGGGCAGCCAGG + Intergenic
906687698 1:47772947-47772969 ACAGCTTTTCTTTGGCAAGAAGG - Intronic
906710713 1:47927691-47927713 ACAGCTTCTTCTTGGCACACTGG - Intronic
907352224 1:53841654-53841676 TCCTCTTGTGCTTGGCAAGGTGG - Intergenic
908095054 1:60729026-60729048 ACAGCTAGGGCTGGGCAAGGTGG - Intergenic
909536526 1:76742090-76742112 ACAGCTGGTGGCTGGCAAGATGG - Intergenic
911880649 1:103234840-103234862 ATAACTTTTGGTTGGCAAGCTGG + Intergenic
912496303 1:110094240-110094262 ACAGATGGTTCTTTGCAAGCAGG + Intergenic
916282666 1:163069454-163069476 ACAGCTTGGAATTCGCAAGCAGG - Exonic
920374510 1:205500521-205500543 ACAGCCTGCCCTTGGCAGGCAGG - Intergenic
922722408 1:227905673-227905695 TCAGCTTGGGCCTGGCCAGCTGG - Intergenic
924802033 1:247334739-247334761 ACAGCGTGTGCTTGCTCAGCTGG + Intergenic
1067224593 10:44367423-44367445 ACAGCTGATGCTGGGCAGGCAGG + Intergenic
1069900972 10:71706504-71706526 TCAGCATGGGCTTGGCACGCTGG + Intronic
1072250401 10:93577803-93577825 ACAGCTTGTAAGTGGCAATCAGG + Intronic
1073608505 10:104920060-104920082 TCAGCTTGTGTTAGGCAAGATGG + Intronic
1074904112 10:117845734-117845756 AAAGCTTAATCTTGGCAAGCTGG + Intergenic
1076383599 10:130041145-130041167 ACAGCTTCTCCCTGGCAAGACGG - Intergenic
1076835199 10:133017396-133017418 ACACCTTGAGCCTGGCAAGGAGG + Intergenic
1078597954 11:12704716-12704738 AGAGCTTCTGCATGCCAAGCAGG - Intronic
1079370875 11:19851200-19851222 ACAGCTAGTAAGTGGCAAGCTGG + Intronic
1084073067 11:66750037-66750059 ACAGATTATCCTTGGCAAGTAGG - Intronic
1084113403 11:67027822-67027844 TCAGCTTGTGCCAGGTAAGCAGG + Intronic
1084214600 11:67640546-67640568 ACAGCCTGTGCTGGGCATTCAGG + Intergenic
1084548969 11:69829394-69829416 CCAGCGTGTGCTGGGCATGCAGG + Intergenic
1084799436 11:71532578-71532600 TCAGCTTGGGCTTGGCATGGTGG + Intronic
1086886188 11:92208608-92208630 ACAGCTTGTTGCTGGCAAGAGGG - Intergenic
1088817877 11:113433776-113433798 CCAGCTTGAGGTTGGCAACCCGG + Intronic
1091391844 12:130686-130708 ACAGCAAGTGCTTGACACGCAGG - Intronic
1092980636 12:13791002-13791024 ACAGCCTGTGCTTGGCATCAGGG + Intronic
1094177386 12:27554959-27554981 CCTTCTTCTGCTTGGCAAGCAGG - Intronic
1102715624 12:114969494-114969516 AGAGGTGGTCCTTGGCAAGCTGG + Intergenic
1103105924 12:118224958-118224980 ACAACTTGGGCTGGGCAAGGTGG + Intronic
1104594975 12:130114870-130114892 AGAGCTTGTGGGTGGCAATCGGG - Intergenic
1106465418 13:30009795-30009817 ACAGCCTGTGCATGGCCATCTGG + Intergenic
1111342849 13:86910680-86910702 ACAGTTTGTGGTTAGCAAGATGG - Intergenic
1117130615 14:52682918-52682940 ACAGATTGGGCTGGGCAAGGTGG + Intronic
1119557070 14:75561413-75561435 AGAGCTTGTGTTTGGAAACCAGG - Intergenic
1124139050 15:27061583-27061605 ACTGCTTGTGACTGGCATGCGGG - Intronic
1125487289 15:40120920-40120942 ACAGATTGAGCTGGGCATGCTGG - Intergenic
1127673955 15:61222757-61222779 ACAACCTGTGCTTGGAAAGAGGG + Intronic
1128683124 15:69665864-69665886 ACTGCCTGGGCTTGGCCAGCGGG + Intergenic
1131848441 15:96512713-96512735 ACAGAATATGCTTGGCAAGGAGG + Intergenic
1133387037 16:5378185-5378207 ACAGCTTCTCCTTGGGAAGTAGG + Intergenic
1134907763 16:17995860-17995882 ACAGCTTTAGCTTGGTAAGTGGG - Intergenic
1138517272 16:57543092-57543114 ACAGTTTGTGCTTGGCAATCTGG + Exonic
1140384463 16:74522338-74522360 ACAGCTAGTGCTTTCAAAGCTGG - Intronic
1141455306 16:84137326-84137348 ACAGCCTGTGCTGTGCATGCGGG - Intronic
1143768236 17:9151396-9151418 AAAGCCTGTCTTTGGCAAGCCGG + Intronic
1146623434 17:34418153-34418175 AAAGTTAATGCTTGGCAAGCGGG + Intergenic
1147438622 17:40433187-40433209 ACAGTTTGTGCATCCCAAGCTGG + Intergenic
1148255825 17:46131044-46131066 TCAGCTTGTGCTTGAAAACCAGG - Intronic
1148259761 17:46171207-46171229 ACAGGTTGTGCAAGCCAAGCAGG - Exonic
1149041647 17:52196823-52196845 CCAGCTGGGGCTTGACAAGCAGG + Intergenic
1151884047 17:76912920-76912942 ACAGCTGATGCTAGGAAAGCAGG - Intronic
1156468033 18:37360377-37360399 ACAGGTTGTGCTCAGCAGGCTGG - Intronic
1157606069 18:48926660-48926682 ACAGCTTGCACCTGGCAACCTGG + Intronic
1158308066 18:56128146-56128168 ACAGATTGTGTTTGGAAGGCAGG - Intergenic
1158680689 18:59563843-59563865 ACAGCATTGGCTGGGCAAGCTGG + Intronic
1160510236 18:79449493-79449515 CTAGCTTGTGCTGGGCACGCTGG + Intronic
1161356939 19:3824419-3824441 ACAGCTGGGGCTTTGCACGCAGG + Intronic
1161622644 19:5306758-5306780 ACAGCTTGTTCTAAACAAGCAGG + Intronic
1164035536 19:21450910-21450932 ACAGCTTGAGCCGGGCATGCTGG + Intronic
1167174011 19:47852984-47853006 ACATCATGAGCTTGGGAAGCCGG - Intergenic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
928199615 2:29239366-29239388 ACAGCTTTTGCTTGGGAAAAGGG - Intronic
929869711 2:45748470-45748492 AACGCCTGTGCCTGGCAAGCAGG + Intronic
930736174 2:54781211-54781233 ACAGCTAGTGAGTGGCAGGCTGG + Intronic
936432100 2:112473598-112473620 ACAGCTTGAGCTTGTCCAGCAGG - Intergenic
940526906 2:154827510-154827532 ACTGTTTCTGCTTGGCAAGTAGG + Intronic
940626534 2:156182267-156182289 ACAGCTTTGGCTTGGCAAATAGG - Intergenic
942164329 2:173227455-173227477 ACAGCTTGAATTTGGCAAGACGG - Intronic
942187833 2:173441127-173441149 ACAGTTTGTTCTTGGCAAAGTGG - Intergenic
944026231 2:195171724-195171746 GCAGCTTGTAAGTGGCAAGCTGG + Intergenic
948087723 2:235265518-235265540 ACAGCGTGGGCTTGGCCAGCTGG + Intergenic
948926407 2:241101556-241101578 AGAGCTTGGGCTTGGCAGGGTGG - Intronic
1170281715 20:14656376-14656398 TCAGGTTGTGCTTTGAAAGCAGG - Intronic
1170445984 20:16428264-16428286 ATAGCTTACACTTGGCAAGCAGG + Intronic
1171006792 20:21474159-21474181 AGAGATTGTGCTAGGCAAACAGG - Intergenic
1171023782 20:21610262-21610284 ACAGCTGGGGCTGGACAAGCAGG - Intergenic
1173697853 20:45036533-45036555 ACATCTTCTCTTTGGCAAGCTGG - Intronic
1176344770 21:5733483-5733505 ACAGCGTGTGACTGGCAGGCAGG - Intergenic
1176351584 21:5854067-5854089 ACAGCGTGTGACTGGCAGGCAGG - Intergenic
1176500057 21:7590972-7590994 ACAGCGTGTGACTGGCAGGCAGG + Intergenic
1176539091 21:8131553-8131575 ACAGCGTGTGACTGGCAGGCAGG - Intergenic
1176558042 21:8314598-8314620 ACAGCGTGTGACTGGCAGGCAGG - Intergenic
1178057683 21:28817818-28817840 ACAGCTAGTGAATGGGAAGCTGG - Intergenic
1178755925 21:35349661-35349683 TCAGCATGTGCTTTGAAAGCTGG + Intronic
1178773390 21:35526527-35526549 AAAGGCTGTGCTTGGGAAGCTGG + Intronic
1179482249 21:41685726-41685748 GCAGCCTGTGGTTGGCAAGGTGG - Intergenic
1179780924 21:43700370-43700392 ACAATTTGTGCTTGAGAAGCAGG - Intergenic
1183074807 22:35420064-35420086 GCAGGGTGTGCTTGGCAACCAGG + Intronic
1203244041 22_KI270733v1_random:47908-47930 ACAGCGTGTGACTGGCAGGCAGG - Intergenic
949874547 3:8617887-8617909 ACAGCTTTTGGTTGACAAGCTGG - Intergenic
949874553 3:8617914-8617936 ACAGCTTTTGGTTGACAAGCTGG - Intergenic
950381726 3:12621223-12621245 ACAGCTTGTAAGTGGCAAACTGG + Intronic
950628129 3:14263460-14263482 ACAGCCAGTGCTGGGAAAGCCGG - Intergenic
951024307 3:17813872-17813894 AAAGGTGGAGCTTGGCAAGCTGG - Intronic
954155008 3:48680594-48680616 ACAGCTAGTGCCTGGTCAGCAGG - Intronic
955000300 3:54921140-54921162 ACAATGAGTGCTTGGCAAGCTGG - Intronic
956124273 3:65996730-65996752 CCAGCTTGTGCTGGGACAGCTGG + Intronic
957717540 3:83949024-83949046 ACAATTTGTTCTTGGAAAGCTGG - Intergenic
963778487 3:149463953-149463975 TAAGCTTATGCTTGGCAAGCAGG - Intergenic
964211113 3:154229100-154229122 ACTGCTTGTGCTTGTAAAGCTGG + Intronic
966894029 3:184428777-184428799 CCAGCTTGTGCCTGGCCAGCTGG - Intronic
967519567 3:190414457-190414479 ACAGAGTGAGCTTGGCAGGCTGG - Intergenic
976417425 4:84794254-84794276 ACAGCTTTTCCTAGGAAAGCAGG - Intronic
981634299 4:146858252-146858274 ACAGCTAGTGCATGGCAGACAGG + Intronic
983679559 4:170337274-170337296 ACAACTAATTCTTGGCAAGCAGG - Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
994367641 5:98933670-98933692 ACGGCCTGTTCTTGGCAAACTGG - Intergenic
995253116 5:110017158-110017180 CCAGCATCTTCTTGGCAAGCAGG + Intergenic
995396060 5:111688461-111688483 ACAGGCTGTGCTAGGAAAGCAGG - Intronic
998184484 5:139968106-139968128 ACAGCTTCTGCTTTCCTAGCAGG + Intronic
1000472741 5:161665952-161665974 ACAGTCTGTAGTTGGCAAGCTGG - Intronic
1002135717 5:177106263-177106285 ACCGCTTGGGGATGGCAAGCAGG + Intergenic
1004075964 6:12344425-12344447 ACAGCTTGAGTGAGGCAAGCAGG + Intergenic
1006992915 6:38230679-38230701 ATGGCTTGTGCTTCCCAAGCCGG - Intronic
1013933794 6:115569189-115569211 ATAGCTTGTGCTTAGCATGGTGG - Intergenic
1016388971 6:143556318-143556340 ACGCCTTGTGCCTGGCACGCAGG - Intronic
1016451537 6:144187645-144187667 CCAGCCTGTGCTTGGAAAGATGG + Exonic
1021337791 7:19425135-19425157 ACAGCTTATGTATGGCAAGTGGG + Intergenic
1021543488 7:21786919-21786941 ACAGCTTTTGTTTGCCAAGTTGG + Intronic
1023862377 7:44224403-44224425 ACAGCTTGTCCTCAGCCAGCAGG - Intronic
1028193877 7:87882248-87882270 ACAGCTGGTGCTGGGAAAACTGG + Intronic
1028218768 7:88168855-88168877 GCAGCTTGTGCTAGGCATTCTGG + Intronic
1028506078 7:91571645-91571667 GCAGTTTGTGCATGGCAAGTTGG + Intergenic
1033077250 7:138261130-138261152 TCAGCTTGTGCTAGGCCTGCTGG - Intergenic
1036724166 8:11204463-11204485 ACAGTTGGTGCTTAGCAGGCCGG - Intergenic
1040533098 8:48282085-48282107 ACAGCGGGTGCTTTGCTAGCAGG - Intergenic
1042212486 8:66394636-66394658 ACAGCTTGGTCTTCCCAAGCAGG + Intergenic
1049958988 9:720428-720450 ACAGCTTGAGCTTGGCAGTTAGG - Intronic
1051513381 9:17904753-17904775 CAAGGCTGTGCTTGGCAAGCAGG - Intergenic
1054745963 9:68853966-68853988 CCGGCTTGTGCCAGGCAAGCTGG + Intronic
1057244082 9:93439621-93439643 ACTTCTTGTGCTGGGCAAGATGG + Intergenic
1057993308 9:99796032-99796054 GCAGATTGTTCTTAGCAAGCAGG - Intergenic
1059403670 9:114086630-114086652 ACAGGATGTTCTTGGCAAGAGGG + Intronic
1059438024 9:114288154-114288176 ACGGCTGGTCCTTTGCAAGCCGG + Intronic
1059693102 9:116705094-116705116 AAAGCTTGAGCTTTGTAAGCAGG + Intronic
1059816304 9:117919649-117919671 ACAGCTTGTGAGTGGAAAGTCGG - Intergenic
1059972052 9:119678222-119678244 GCAGCTTGTCCTTGGGAAGGAGG - Intergenic
1060287024 9:122262870-122262892 ACAGTTTGTGCTGGGCATGGTGG - Intronic
1060928700 9:127474123-127474145 ACAGCTTGTGCTTGGCAAGCTGG - Intronic
1061679210 9:132234606-132234628 ACAGCTTGACATTGGCAGGCGGG - Intronic
1062453730 9:136626287-136626309 ACAGCAGGCACTTGGCAAGCCGG - Intergenic
1203460369 Un_GL000220v1:30995-31017 ACAGCGTGTGACTGGCAGGCAGG - Intergenic
1186446644 X:9635585-9635607 ACAGACAGTGCTTGCCAAGCAGG + Intronic
1190025510 X:46918670-46918692 ACATCTGGTGGTTGGCAGGCTGG + Intronic
1194244600 X:91495007-91495029 ACATCTTGTGCTTAGCCACCTGG - Intergenic
1194279149 X:91925567-91925589 ACAGCTAGTGCCTGGCAACAAGG - Intronic
1195300852 X:103528565-103528587 ACTGCTTGTACTTGGCAGGGAGG + Intergenic
1198057438 X:133008791-133008813 ACAGCATGTACTTGAAAAGCTGG - Intergenic
1200563577 Y:4736320-4736342 ACATCTTGTGCTTAGCCACCTGG - Intergenic
1200596622 Y:5149069-5149091 ACAGCTAGTGCCTGGCAACAAGG - Intronic