ID: 1060929395

View in Genome Browser
Species Human (GRCh38)
Location 9:127479421-127479443
Sequence GCTCCCGCTGCCCCAGTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060929395_1060929399 13 Left 1060929395 9:127479421-127479443 CCTGGAACTGGGGCAGCGGGAGC 0: 1
1: 0
2: 0
3: 42
4: 371
Right 1060929399 9:127479457-127479479 TCAGCAGAGCAGCAGCCAGAAGG 0: 1
1: 1
2: 2
3: 34
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060929395 Original CRISPR GCTCCCGCTGCCCCAGTTCC AGG (reversed) Exonic
900129619 1:1081866-1081888 GTTCCCGCTGGCCCAGGTCCCGG + Exonic
900165026 1:1241123-1241145 GTCCCCGCTGACCCAGCTCCAGG + Intergenic
900238364 1:1603195-1603217 TCTCCAACTGCCCCAGCTCCAGG + Intergenic
900292012 1:1927617-1927639 GCTCCCGCTTCCGCATCTCCAGG + Exonic
900362005 1:2293671-2293693 GTTTCCGCTGCCCCTGTTCTTGG + Intronic
900365943 1:2312045-2312067 GCTCCCAGTACCCCTGTTCCTGG + Intergenic
900465773 1:2824820-2824842 CCTCCCTCTGCCCCATGTCCAGG + Intergenic
900470399 1:2851280-2851302 GCTCCCCCTCCCCCAGCCCCAGG - Intergenic
900500301 1:3001290-3001312 GGTCCTGCAGCCTCAGTTCCTGG + Intergenic
901011802 1:6206461-6206483 GCTCCCGCGGCCCCTCTGCCCGG - Intronic
901752398 1:11418716-11418738 GCTCCTGCTCCCCCAGAGCCAGG + Intergenic
901801056 1:11708194-11708216 GCTCCGGCTCCGCCAGCTCCAGG + Intronic
901812620 1:11776519-11776541 GCTCCTGCTGCCCCTGGGCCTGG - Exonic
901869334 1:12128313-12128335 GCACCCTCTGCCCCAGGTCTGGG - Intronic
902341241 1:15784900-15784922 GCTGACCCTGCCCCACTTCCAGG + Intronic
902404575 1:16175663-16175685 GCCCCTGCTGCCCCAGGCCCAGG - Intergenic
902522001 1:17024015-17024037 GCACCAGCTGCCCCAGCTACTGG - Exonic
903184866 1:21623133-21623155 GCCCTAGCTGCCCCAGATCCTGG + Intronic
903262178 1:22137227-22137249 GCTCCCCCTCCCCCATGTCCTGG - Intronic
903385567 1:22924128-22924150 TTTCCACCTGCCCCAGTTCCTGG + Intergenic
903859439 1:26356058-26356080 GGTCCCTCTTCCCCACTTCCTGG - Intergenic
903888524 1:26555058-26555080 GACCCCTCTGCCCCAGTCCCAGG - Intronic
904063062 1:27726183-27726205 CCTCCTGCGTCCCCAGTTCCCGG - Intronic
904373389 1:30065127-30065149 GCTCCTGCTGCCTCTGTTCCCGG + Intergenic
904497435 1:30895092-30895114 CCTCCCCCTGCCTCAGCTCCAGG - Intronic
905183104 1:36178534-36178556 GCTCCCGCTGCTCCCGGGCCTGG - Exonic
905277493 1:36828014-36828036 GCTGCCGCCACCCCAGCTCCTGG + Intronic
905562359 1:38937570-38937592 GCCCCCGCATCCCCAGTTCCAGG + Intronic
905664277 1:39753172-39753194 GCTGCTGCTGCCCAGGTTCCGGG + Intronic
905878720 1:41449703-41449725 CCTCCTTCAGCCCCAGTTCCTGG - Intergenic
906024059 1:42658244-42658266 ACTCCCGCGTCCCCAGTGCCAGG + Intergenic
906069684 1:43007705-43007727 GCTGCCGCAGCCCCAGGCCCGGG - Intergenic
906149452 1:43579073-43579095 GCTCCCACTGGGCAAGTTCCTGG + Intronic
907320120 1:53596709-53596731 GCTCGGGCTGCTCCAGTTGCAGG - Intronic
907378773 1:54067339-54067361 CCTCCCGCTTCCCCAGTTTTTGG - Intronic
907430825 1:54410268-54410290 ATTCCTGCTGCCCCAGTTGCTGG - Intronic
908259068 1:62325648-62325670 GCGCCCACTGGCCCAGCTCCGGG - Intergenic
910646919 1:89524599-89524621 GCTCCCGCAGCCCCAGAGCTGGG + Intergenic
913552086 1:119925700-119925722 GCTGCTTCTGCCCCAGTCCCCGG - Exonic
913600973 1:120420937-120420959 GCTCCCACTCCCCCAGGACCTGG - Intergenic
914086083 1:144455696-144455718 GCTCCCACTCCCCCAGGACCTGG + Intronic
914191975 1:145419647-145419669 GCTCCCACTCCCCCAGGACCTGG + Intergenic
914362110 1:146944379-146944401 GCTCCCACTCCCCCAGGACCTGG - Intronic
914489516 1:148142576-148142598 GCTCCCACTCCCCCAGGACCTGG + Intronic
914589882 1:149097597-149097619 GCTCCCACTCCCCCAGGACCTGG + Intronic
914947525 1:152080005-152080027 GTGCTCCCTGCCCCAGTTCCGGG - Intergenic
915356000 1:155255439-155255461 GCTCCGGCTGCCGCAGGTCGGGG + Intronic
915600449 1:156920265-156920287 GATCCCCCAGGCCCAGTTCCAGG + Intergenic
915693073 1:157710030-157710052 GCTCCCGTTCCTCCAGTTACCGG - Intergenic
915906434 1:159881480-159881502 GTTCGCTCTGCCCCAGTTACAGG + Intronic
919092835 1:192994706-192994728 GCTCCGGCTGCTCCAGCCCCAGG - Intergenic
919838853 1:201594789-201594811 GCTCCCAGAGCCCCAGTTTCAGG - Intergenic
922811297 1:228416834-228416856 GCACCCGCTGCGCCTGTCCCCGG - Intronic
922950934 1:229558295-229558317 GCTCCCGCGCGCCCGGTTCCCGG - Exonic
923146832 1:231204071-231204093 GCTCCCACTGCCCCAGACTCTGG + Intronic
923198205 1:231687764-231687786 TTTCCCCCTGCCCCAGTCCCTGG - Intronic
923480155 1:234376247-234376269 GCTCCCACTCCCACACTTCCGGG + Intronic
1063781306 10:9328247-9328269 GCTCCAGCCTCCCCAGTTGCTGG - Intergenic
1064243414 10:13650617-13650639 CCTCCCCCAGCCCCAGTGCCAGG - Intronic
1066026369 10:31363247-31363269 GTGCTCCCTGCCCCAGTTCCGGG - Intronic
1066333035 10:34445931-34445953 CCCACCGCAGCCCCAGTTCCAGG + Intronic
1069362890 10:67663536-67663558 CCTGCGGCTGCCCCAGATCCTGG - Intronic
1069746430 10:70717668-70717690 CCTCCCTGTGCTCCAGTTCCAGG - Intronic
1069774748 10:70919798-70919820 GCTCCCTCTGTCCCACATCCAGG + Intergenic
1069779252 10:70944500-70944522 GCCCCCATTCCCCCAGTTCCTGG + Intergenic
1069896924 10:71685688-71685710 TCTCCGGCTGCCCCAGGGCCAGG - Intronic
1070059271 10:72966953-72966975 GTCCCCCCAGCCCCAGTTCCAGG - Intergenic
1070328251 10:75401498-75401520 CCTCCCGCTGCTCCTGCTCCCGG - Exonic
1070778655 10:79125019-79125041 CTTCCTGCTGCCACAGTTCCTGG - Intronic
1070800491 10:79242350-79242372 GCTCCCGCTCCCCGACTTCGGGG - Intronic
1070801111 10:79244848-79244870 GCTCCGGCTCCCCCAGTTATGGG + Intronic
1071068819 10:81668137-81668159 GCACTTGCAGCCCCAGTTCCAGG + Intergenic
1071328672 10:84540639-84540661 GCTCCCGGCGGCCCATTTCCCGG + Intergenic
1071519363 10:86319525-86319547 CCTCCCCCTGCCCCAGGCCCCGG + Intronic
1071566010 10:86671592-86671614 GCTCCCCCTTCTCCACTTCCTGG - Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1074764221 10:116688631-116688653 GCTACAGCTGCACCAGTTCGGGG + Intronic
1075141278 10:119838541-119838563 TATCCAGCTGCCCCTGTTCCAGG + Exonic
1075525980 10:123187126-123187148 GCTCTGGCTTCCCCTGTTCCAGG + Intergenic
1075583783 10:123642970-123642992 GTTTCCTCTGCCCCAGTACCTGG + Intergenic
1076381471 10:130027183-130027205 TCTCCCCCTGCCCCACTTCAGGG + Intergenic
1076872511 10:133200763-133200785 GCTCCCACTGTCCCAGTGGCCGG - Intronic
1077365513 11:2159983-2160005 GCTCCACCTGCCCCACTGCCAGG + Exonic
1078461958 11:11521002-11521024 GCTCCCCGTGCCCTTGTTCCTGG + Intronic
1078682034 11:13486308-13486330 ACTCCAGCTGCCCCAGTCCCAGG - Intergenic
1079246238 11:18754273-18754295 TCTCCAGCTCTCCCAGTTCCAGG - Intronic
1081073781 11:38642816-38642838 GCTACCCCTTCCCCAGTGCCAGG - Intergenic
1081864632 11:46352739-46352761 TCTTCCGCTCCCCGAGTTCCTGG + Intronic
1082768648 11:57188274-57188296 ACTCTTGCTGCCCCAGTTGCTGG - Exonic
1083593682 11:63909245-63909267 GCCCCCGCCGCCCCCGCTCCTGG - Exonic
1083672166 11:64305721-64305743 GCTGCCGGAGCCCCAGGTCCGGG + Intronic
1083679597 11:64345007-64345029 GCTCCCACTGCCTCCGCTCCCGG - Exonic
1083849235 11:65355449-65355471 GCCCCCTCGGCCCCAGTCCCAGG + Intronic
1084092239 11:66886234-66886256 GCTCCAGCCGCCCCAGCACCTGG - Intronic
1084150371 11:67285342-67285364 GCACCCGCTGCACCAGCTGCTGG - Exonic
1084205057 11:67586350-67586372 GCTCCCGCTGGCTGAGTCCCTGG + Intronic
1084415879 11:69032754-69032776 GGTCCCCCTGCTCCTGTTCCCGG - Intergenic
1084599708 11:70137548-70137570 CCTCCTGGTGCCCCAGCTCCAGG + Intronic
1084833522 11:71787215-71787237 GCTTCCGAAGCCCCACTTCCAGG + Intergenic
1085304522 11:75477587-75477609 GGTCCCTCTGACCCTGTTCCAGG + Intronic
1086622963 11:88910075-88910097 GTTCCCACTTCCCCAGTCCCTGG + Intronic
1087077344 11:94137451-94137473 GCTCTCGCTGCCTCAGTTAGGGG - Intronic
1089519993 11:119057031-119057053 GCTCCTGCGGCCCCAGCTCTGGG + Exonic
1091207294 11:133830580-133830602 GCACCCCCTGCCCCTGGTCCTGG - Intergenic
1091548909 12:1523266-1523288 GCACCCCCTGCCCCAGGCCCAGG - Intergenic
1091683110 12:2540878-2540900 GCTCCTGCTGTTCCAGCTCCTGG - Intronic
1092728338 12:11506051-11506073 ACCCCCGCTGCCCCATTTTCTGG + Intergenic
1095763768 12:45870615-45870637 CCTCCCTCGCCCCCAGTTCCTGG + Intronic
1095956742 12:47810988-47811010 CCTTCCTCTGCCCCAGATCCAGG - Intronic
1096521134 12:52185425-52185447 CCTCCAGCTGCCCCCGCTCCTGG + Exonic
1096748373 12:53743364-53743386 GCTCCCCCAACCCCAGCTCCTGG + Intergenic
1102899404 12:116624741-116624763 CCTCCAGCTGCTCCAGCTCCCGG - Intergenic
1102964740 12:117117343-117117365 TCTCCCCCTGCCCCAGCCCCTGG + Intergenic
1103073618 12:117965037-117965059 GGTCCCACTTCCCCACTTCCCGG + Intronic
1103920974 12:124399052-124399074 ACTCCCCCTGGCGCAGTTCCAGG - Intronic
1103972357 12:124680032-124680054 GCTCCGGGTGCCCCAGGCCCTGG - Intergenic
1105022837 12:132828731-132828753 GCTCCCGCTCCCGCAGTGCATGG - Intronic
1105609520 13:21955749-21955771 GCTGCCTTTGCTCCAGTTCCCGG + Intergenic
1106849653 13:33775874-33775896 GCTCCAGCTGCTTCTGTTCCTGG + Intergenic
1106861474 13:33913292-33913314 TCTCCCGTTCCCCCAGTGCCTGG - Intronic
1107808123 13:44174119-44174141 GCCACCCCTACCCCAGTTCCAGG - Intergenic
1109055504 13:57542378-57542400 GCTCCTGAACCCCCAGTTCCTGG - Intergenic
1109829604 13:67769893-67769915 GCTCCCGCTGCCCCACAGCTCGG + Intergenic
1110626728 13:77661824-77661846 GTGCTCCCTGCCCCAGTTCCGGG - Intergenic
1112342726 13:98565966-98565988 GCTCCCTCTGCTCCAGCACCAGG + Intronic
1112658169 13:101474689-101474711 GTTACCCCTCCCCCAGTTCCAGG + Intronic
1113060504 13:106317165-106317187 GCCCCAGCTGCCCCATTCCCTGG - Intergenic
1113849124 13:113407970-113407992 GCTCCTGCAGGCCAAGTTCCTGG - Intergenic
1115340231 14:32285984-32286006 TCTTCAGCTGCTCCAGTTCCTGG - Intergenic
1117565126 14:56986642-56986664 CCTCCCGCTTCCCCATTGCCAGG - Intergenic
1117690235 14:58298758-58298780 GCTGCTGCTGCCCGAGGTCCCGG + Intronic
1118912010 14:70069478-70069500 GGTCCAGCTGCCCCAGGTCAAGG - Intronic
1121302391 14:92881780-92881802 GCTCCCGAGGCCCCAGATGCTGG - Intergenic
1122414544 14:101542675-101542697 GCTCCCGCTCCCCTACTTCCTGG + Intergenic
1122799717 14:104223458-104223480 GGTCCCCCTGGCGCAGTTCCAGG - Intergenic
1122813671 14:104301713-104301735 ACTCCAGCTGCCTCATTTCCTGG + Intergenic
1122844147 14:104481577-104481599 GCCCCTGCTGCCCCGGGTCCTGG + Intronic
1122988532 14:105225072-105225094 GCTCCGGCTGCCACATTCCCGGG + Intronic
1123215130 14:106802567-106802589 CCTACCGCTGCACCTGTTCCTGG + Intergenic
1123851512 15:24361986-24362008 GCCCCAGCTGCTCCAGCTCCAGG - Intergenic
1124463904 15:29919269-29919291 GGGCCTGCTGCCCCTGTTCCTGG - Intronic
1124596915 15:31098838-31098860 GCTCCCGCTCCCCCAATCCCTGG - Intronic
1125759824 15:42088814-42088836 GCTCCCACTGCCCCACTCCCCGG - Intronic
1126755871 15:51924333-51924355 CCTCCCTCTGCCCCACCTCCTGG + Intronic
1127942748 15:63716350-63716372 GCTCCGGATGCCCCTCTTCCCGG + Exonic
1128719750 15:69939753-69939775 GCTGCTGCTGCCCCAACTCCTGG - Intergenic
1129114468 15:73357612-73357634 GCTCCTGCTGCATCACTTCCCGG + Intronic
1129450212 15:75647475-75647497 GCTGCCGCTGCCTCGCTTCCTGG - Intronic
1129723360 15:77889683-77889705 GCTCCCACTGCCCCAGGGTCAGG - Intergenic
1129785354 15:78306565-78306587 GCTGCCTCCGCCCCAGTTCCGGG + Intergenic
1130859729 15:87875416-87875438 GCTCCCTCTGCCCCAGCACTGGG - Intronic
1130948534 15:88567629-88567651 GCTCCAGCTGCCCCCATTACAGG - Intergenic
1131445728 15:92496792-92496814 GCTTCCACTGCCCCCGTCCCCGG + Intronic
1132337372 15:101056966-101056988 CCTCCGGCTGCCCCAGAACCGGG - Exonic
1132347199 15:101115512-101115534 GCTCCTGCTGCCCCTGTCCCTGG + Intergenic
1132676421 16:1123109-1123131 GCTCCCGCTGCCACAGGGCTGGG + Intergenic
1132720175 16:1311861-1311883 GCTCTCGCTTCCCCAGCCCCAGG - Intronic
1132838812 16:1968336-1968358 GCTCCCGGTTCCCTGGTTCCTGG + Intronic
1132938731 16:2496415-2496437 CCTGCCGCTGCCCGAGTTCGTGG + Exonic
1136096978 16:27963712-27963734 TCTCCCTCTGCCCCCGTTCCTGG + Intronic
1136349342 16:29696929-29696951 GCTCCCTGCGCCCCAGTGCCAGG + Intronic
1136514803 16:30761782-30761804 GCTCCCGCCGCCTAGGTTCCAGG + Exonic
1136541644 16:30930522-30930544 GCTCCCGCGGCCCGAGGTGCTGG - Exonic
1137762976 16:50955607-50955629 TCCCCAGCTGCCCCAGTTGCTGG - Intergenic
1137928211 16:52562070-52562092 GCTCCCACTGCAGCAGTGCCCGG + Intergenic
1138203495 16:55107335-55107357 GCTGCCTGTGCCCCAGTGCCTGG + Intergenic
1138829379 16:60358903-60358925 GTGCTCCCTGCCCCAGTTCCGGG - Exonic
1141651689 16:85396271-85396293 ACTCCCCCCGCCCCAGTGCCTGG - Intergenic
1142631434 17:1228982-1229004 CCTCCCGCTGCTCCAGGTCGCGG + Intronic
1142717670 17:1755778-1755800 ACCCACGCTGCCCCAGCTCCTGG - Intergenic
1145263291 17:21367245-21367267 GCTGCTGCTGCCACTGTTCCCGG - Intergenic
1145723179 17:27090956-27090978 TCTCCCCAGGCCCCAGTTCCTGG + Intergenic
1146061154 17:29608014-29608036 GCACCAGCTGCACCAGCTCCAGG - Exonic
1146327731 17:31901567-31901589 GCTCCAGCTGTTCCAATTCCGGG + Exonic
1146699238 17:34940180-34940202 CCTCCCACTGCCCCAGCCCCTGG + Intronic
1147145893 17:38484306-38484328 CCTCACGCTGCCCCACTCCCTGG - Intronic
1147375793 17:40021868-40021890 TCTGCCGCTGCCCCAGCTGCAGG - Intronic
1147427962 17:40355267-40355289 GGTCCGGCTGCTCCAGGTCCTGG - Exonic
1148611426 17:48967184-48967206 GCTGCTGCTGTCCCTGTTCCTGG - Exonic
1149626524 17:58083949-58083971 GCTGCCGCTGCCCCCGCCCCCGG + Intronic
1150060478 17:62065037-62065059 GGTCCAGATGCCCGAGTTCCCGG - Intronic
1150176796 17:63066106-63066128 GCTCCAGCTGACCCAGGTCCAGG - Intronic
1150388273 17:64776846-64776868 GCTCCCGGTGGCGCACTTCCCGG - Intergenic
1150791183 17:68201116-68201138 GCTCCCGGTGGCGCACTTCCCGG + Intergenic
1150802038 17:68290617-68290639 CCTCGCGCTGCCTCAGTGCCCGG + Intronic
1151316106 17:73323765-73323787 GCTCCAGCTGACCCATTTCCTGG + Intergenic
1151498666 17:74474786-74474808 GCTCCCTTTGCCCCAGGCCCAGG + Intronic
1151933343 17:77247016-77247038 CCTCCCCCTGCCCCCGCTCCCGG - Intergenic
1152319591 17:79601040-79601062 GCTCCCGCTGCTCCCGCCCCGGG + Intergenic
1152377393 17:79925775-79925797 GGTCCCCCGGCCCCAGGTCCTGG + Intergenic
1152544166 17:80992342-80992364 GCTCCCGCGGGCCCAGAGCCAGG - Intronic
1153262477 18:3237966-3237988 GCCACCCCTGCCCCAGTCCCTGG - Intergenic
1153328418 18:3846783-3846805 GGTCCCCCTACCCCAGGTCCAGG - Intronic
1154105464 18:11518965-11518987 GCTGCCTCTGCCCCAGTGCCAGG + Intergenic
1155434374 18:25796058-25796080 GCTCTTGCTGCCTCAGTTCGGGG + Intergenic
1157597898 18:48875020-48875042 GCTCCCGCTGTCCCTGGGCCAGG + Intergenic
1157886066 18:51367968-51367990 TCTCTCCCTGCCCCAGTCCCTGG + Intergenic
1160707457 19:536174-536196 GCTCCCAGTGCCCCAGGTCCCGG - Intronic
1160963719 19:1736389-1736411 TCTCCCTCTGGCCCAGTTCTGGG - Intergenic
1161206562 19:3044338-3044360 GCTCCCTATGCCCCAGCTCCTGG + Intronic
1162720003 19:12656681-12656703 ACCCCCGCCTCCCCAGTTCCAGG - Exonic
1162735561 19:12745266-12745288 GCTCCCTCTGGCCCTGTGCCCGG + Intronic
1162956747 19:14102981-14103003 GCTCCGGCATCCCTAGTTCCAGG - Intronic
1164483617 19:28635645-28635667 GCTCCCCCATCCCCAGTACCTGG - Intergenic
1165354645 19:35296008-35296030 CGCCCCGCTGCCCCAGCTCCCGG - Intronic
1166373388 19:42314405-42314427 GCACAGGCTGCCCCAGCTCCCGG + Intronic
1166766406 19:45254121-45254143 GCTCCCCCACCCCAAGTTCCAGG + Intronic
1167152905 19:47719780-47719802 CCTCCCGCTGTCCCAGGTCCAGG - Intronic
1167425883 19:49429296-49429318 GCTCCTCCTTCCTCAGTTCCAGG - Intergenic
1167456674 19:49599866-49599888 GCCCCCGCGGCTGCAGTTCCAGG + Exonic
1167638118 19:50666969-50666991 GCTCCCGCTGCCCCACAGCCTGG - Exonic
1167660378 19:50792633-50792655 GCTCCCGCTGCCCAGGTTTTGGG - Intronic
1167671458 19:50856093-50856115 GCTCCCCCTGCCCATGTCCCAGG + Intronic
1167792831 19:51691718-51691740 GTTCTCGCTGCCCCTGCTCCAGG - Intergenic
1167952333 19:53037467-53037489 GGCCCCGCAGCCCCAGTCCCAGG - Intergenic
1168126373 19:54285785-54285807 GCCCCTGCTGCCCCAGGCCCAGG + Intergenic
1168283988 19:55321398-55321420 GCTCACCCAGCCCCAGTCCCAGG - Intronic
1168284284 19:55322675-55322697 GCTCACCCAGCCCCAGCTCCAGG - Exonic
1168631119 19:57956923-57956945 CCTCCTGCTGCCCCAGCTCCTGG + Intergenic
925185203 2:1842397-1842419 GCCCCTGCTGCCCCACCTCCTGG + Intronic
926414294 2:12633853-12633875 TCTCCCACTGTCCCAGGTCCAGG - Intergenic
928572786 2:32625891-32625913 GCTCTGGCTGCCACAGTTCCAGG - Intergenic
929557849 2:42936700-42936722 CCTCACCCTGCCCCATTTCCTGG + Intergenic
930568891 2:53059577-53059599 CCTCCCACCACCCCAGTTCCTGG - Intergenic
932063285 2:68528662-68528684 GTGCTCCCTGCCCCAGTTCCGGG - Intronic
933704469 2:85279543-85279565 GCTCCTGCTGCCCCAATTCACGG + Intronic
933897239 2:86823130-86823152 ATTCCCCCTCCCCCAGTTCCAGG + Intronic
934113935 2:88766207-88766229 CCTCCCGCAGCCCCGGCTCCCGG - Intergenic
934616714 2:95775793-95775815 TCTGCAGCTGCCCCAGATCCAGG + Intergenic
934636093 2:95991479-95991501 CCTCCCGCAGCCCCGGCTCCCGG + Intronic
934644176 2:96048767-96048789 TCTGCAGCTGCCCCAGATCCAGG - Intergenic
934797553 2:97113947-97113969 CCTCCCGCAGCCCCGGCTCCCGG - Intronic
934835859 2:97589492-97589514 CCTCCCGCAGCCCCGGCTCCCGG + Intronic
934837591 2:97604858-97604880 TCTGCAGCTGCCCCAGATCCAGG - Intergenic
935361511 2:102250375-102250397 ACTCCCACAGCCCCAGCTCCTGG + Intergenic
936927578 2:117753345-117753367 ACTCCAGCTCCCCCACTTCCTGG - Intergenic
939966519 2:148615692-148615714 CTTCCCACTGCCCCAGTTCCTGG - Intergenic
941123092 2:161554101-161554123 CCTCCCCCGGCCCCATTTCCAGG - Intronic
941580730 2:167293226-167293248 GCTGCCGCTGCCCCGATCCCCGG - Intergenic
942054786 2:172172538-172172560 GCTCCCGCGGCCACATTTCCTGG + Intergenic
942890229 2:180980184-180980206 GCTCCCGGGGCCCCAGTACCTGG - Intronic
942972215 2:181970846-181970868 GCCACCACTGCCCCAGTTCACGG + Intronic
944904974 2:204253080-204253102 ACTCCCCCTGCCCCAGACCCTGG + Intergenic
946312156 2:218888322-218888344 CCTCCCCCTGCCACAGGTCCAGG + Intronic
947946663 2:234109467-234109489 CCTCCAGCTGCTCCAGCTCCTGG + Intergenic
948320416 2:237064419-237064441 GCTATCGCTGCCGCAGTACCGGG + Intergenic
948700465 2:239756581-239756603 GCTCCCAGTGCCCTGGTTCCTGG - Intergenic
948711271 2:239827245-239827267 CCTCCCCCTGCCCCAGTCCTTGG + Intergenic
1168849248 20:965353-965375 TCTCCGGCTTGCCCAGTTCCAGG - Intronic
1170032305 20:11956206-11956228 TCTCCTGCTTCCCCACTTCCAGG - Intergenic
1170312964 20:15012719-15012741 GCTCCCCCTACCCCATTTCCCGG + Intronic
1170779265 20:19409236-19409258 GCTCCTGCTGCGCCTCTTCCTGG - Intronic
1172671190 20:36635433-36635455 GCTTCCCCTGCCCCACTTCCTGG - Intronic
1172889928 20:38256996-38257018 GCTTCCACTGCCCCACTCCCTGG + Intronic
1172956745 20:38765404-38765426 GCTCCAGCTGCTCCAGGTCAGGG - Exonic
1174300655 20:49579946-49579968 GCTCCTGCTCCCCGCGTTCCCGG - Intergenic
1175257363 20:57655418-57655440 GCTACCGTTTCCCCAGTGCCAGG + Intronic
1175818844 20:61897649-61897671 GGACCCTCTGCCCCAGTCCCAGG - Intronic
1175965229 20:62657012-62657034 GTTCGCGCTGCCCCACTTCACGG + Exonic
1176030425 20:63008752-63008774 CCTCCTGCTCCCCCAGCTCCGGG - Intergenic
1179552188 21:42150508-42150530 CGTCCCTCTGCCCCAGCTCCTGG - Intergenic
1179981739 21:44899518-44899540 GCTCTCCCTACCCGAGTTCCGGG + Intronic
1180799923 22:18626967-18626989 GCTCTCCCTCCTCCAGTTCCTGG - Intergenic
1181026950 22:20132109-20132131 GCGACCGCTGCCCCCGTGCCCGG - Intronic
1181099597 22:20530564-20530586 GCTCCCCCTGCCACACTGCCAGG - Intronic
1181221792 22:21368299-21368321 GCTCTCCCTCCTCCAGTTCCTGG + Intergenic
1181494244 22:23279035-23279057 GCTCCAGCTCCACCACTTCCTGG - Intronic
1181637166 22:24179913-24179935 GCTCTCCCTCCTCCAGTTCCCGG + Intergenic
1182026159 22:27120901-27120923 GCTCCCCAGGCCCCAGCTCCCGG + Intergenic
1182457136 22:30459046-30459068 ACACCCCCTGCCCCAGGTCCTGG + Intronic
1182548306 22:31088015-31088037 GCTCCTGCCGCTGCAGTTCCCGG - Exonic
1182551387 22:31102688-31102710 GCTCAGGCTGCCCCAGTGACAGG - Intronic
1183255502 22:36759070-36759092 CCTCCTGCAGCCCCAGTTCCTGG - Intronic
1184233095 22:43168974-43168996 GCTGCCCCTGCCCAAGTCCCGGG + Intronic
1184704594 22:46201947-46201969 GCTCCCGCAGCCCCACCCCCAGG + Intronic
1185047275 22:48534718-48534740 CCTCCCCCTCCCCCCGTTCCAGG - Intronic
1185108328 22:48886685-48886707 GCTCCTGCTGCACTAGCTCCTGG - Intergenic
1185157119 22:49199809-49199831 GCTCCCTCTGCCCGACTCCCAGG - Intergenic
1185164091 22:49247713-49247735 CTTCCGGCTGCCCCCGTTCCTGG + Intergenic
1185273332 22:49938471-49938493 GTTCCCGCCTCCCCGGTTCCTGG - Intergenic
950422614 3:12907676-12907698 GCTCCCGGTGCCCCACTCCCAGG + Intronic
952743856 3:36760148-36760170 GCTCTCTCTACCCCAGCTCCAGG + Intergenic
953385834 3:42505181-42505203 GCAACCCCTGCCCCAGTTCTAGG - Intronic
953389084 3:42524215-42524237 TCTTCCTCAGCCCCAGTTCCAGG - Intronic
953874817 3:46660707-46660729 GGCACCGCTGCCCCAGCTCCAGG + Intergenic
953934737 3:47031072-47031094 CATCCCTCTTCCCCAGTTCCTGG - Intronic
954317178 3:49807495-49807517 GCTGCAGCTCCCCCAGATCCTGG + Intronic
954555993 3:51518145-51518167 GCTCCAGCAGCCCCAGCCCCAGG - Intergenic
954686563 3:52373256-52373278 GCTCTCGCTTCCCCTTTTCCAGG - Intronic
954909292 3:54089084-54089106 CCTCCCTCTGCACCAGCTCCTGG + Intergenic
960487286 3:118269694-118269716 CCGCGCGCAGCCCCAGTTCCAGG - Intergenic
960941090 3:122935301-122935323 GCTCCCCCAGCCCCACTTCCAGG - Intronic
961372586 3:126440631-126440653 CCTCCCCCTGCCCCTGCTCCTGG + Intronic
961536264 3:127572877-127572899 GCTGCCGCTGCCCCTGCCCCTGG - Intergenic
961964957 3:130893523-130893545 GCTCACGGTGCTCCAGTCCCTGG + Intronic
962374800 3:134850846-134850868 GCTCCAGCTGACCCTGCTCCTGG - Intronic
962444701 3:135454244-135454266 GGTTCAGCTGCCCCAGTTCTGGG + Intergenic
966866586 3:184261667-184261689 ACTCCAGCTGCCTCTGTTCCCGG - Intronic
966913006 3:184569620-184569642 CCTCCCGCTGCCGCAGCCCCTGG - Intronic
968205040 3:196792031-196792053 GCTGCCCCTGCACCAGTTGCTGG + Intronic
968501515 4:952286-952308 GCTCACCATGGCCCAGTTCCAGG + Intronic
968628058 4:1637020-1637042 GCTCCCGCTGCACCAGAGCACGG + Intronic
968650596 4:1758859-1758881 GCTTCCGCTGGCCCAGGGCCTGG - Intergenic
969414313 4:7048740-7048762 CCTCCCCCTTCCCCAGTCCCTGG + Intronic
969494708 4:7519975-7519997 GCTCCTGCTCTGCCAGTTCCAGG + Intronic
972775908 4:42240253-42240275 CTTCCCCCTCCCCCAGTTCCTGG - Intergenic
972974376 4:44615568-44615590 GCTCCCACTGACCCAGTGACAGG - Intergenic
974328358 4:60444410-60444432 ACTCACCCTGCCCCAGTACCAGG - Intergenic
976218545 4:82737511-82737533 GTTCCTGCTGCCCCATTTTCTGG + Intronic
978534818 4:109749904-109749926 GCTGCCACTGCCACAGTGCCTGG - Intronic
981164456 4:141540854-141540876 ACTCCCACTCCCCCAGTTCCTGG - Intergenic
982184115 4:152779381-152779403 CCTCGCGCTGCCCCCGTGCCTGG - Intronic
984651967 4:182280100-182280122 AATCCAGCTTCCCCAGTTCCTGG + Intronic
984973543 4:185210313-185210335 GCTCCCGCGCCCCGAGCTCCGGG + Intronic
985512798 5:321742-321764 GCACCCGCCGCCACAGCTCCTGG + Intronic
985533713 5:449452-449474 GCACCCTCTGCCCCAGCTCCTGG + Intronic
992084847 5:73269284-73269306 GCTCCAGCTGCTCCAGGACCTGG - Intergenic
994217202 5:97151067-97151089 GCCCCAGCTTCCCCAGTACCAGG - Intronic
995047976 5:107671409-107671431 GCTGCCGCTTAACCAGTTCCAGG - Intergenic
995512382 5:112922009-112922031 GCCGCCGCTGCCCCAGCTGCTGG - Intronic
996726904 5:126680484-126680506 GCTCCCCCTTCCACAGTGCCCGG + Intergenic
996814576 5:127560542-127560564 CCTCCCGCTCCCCCAGCCCCTGG - Intergenic
997428885 5:133823774-133823796 CTTCCCCATGCCCCAGTTCCAGG - Intergenic
998092182 5:139378002-139378024 GCTCACGCTGCCCAATTACCTGG - Exonic
998199526 5:140108243-140108265 GCTGCCACTGCCACAGCTCCAGG + Intronic
999240205 5:150123034-150123056 GCTCCCCCTGCCCAGGTACCAGG - Exonic
999260194 5:150233541-150233563 GCTGCCTCTGCCCCAGCCCCAGG - Intronic
1001911022 5:175517866-175517888 GTTCCCACTGCCCCAGGGCCAGG + Intronic
1002103811 5:176870096-176870118 GCCCTCGCTGCCCCAGGGCCAGG + Intronic
1002312457 5:178323103-178323125 CCTTCTGCTGCCCCAGATCCAGG - Intronic
1002421960 5:179153559-179153581 GCCGGCGCTGCCCCAGCTCCCGG - Exonic
1002810074 6:620273-620295 GCGCCCCCTGCCCCATTTGCAGG + Intronic
1003142944 6:3486688-3486710 TCTCCCTCTCCCCCACTTCCTGG - Intergenic
1003399014 6:5776233-5776255 CCTCTCGCTGGCCCACTTCCTGG - Intergenic
1003600328 6:7511039-7511061 GCAGCAGCTGCCCCAGGTCCTGG + Intergenic
1004734075 6:18387364-18387386 GCTCCCGCTGCAACAGTCCCGGG + Exonic
1006867473 6:37221102-37221124 TTTCCCCCTGCCCCAGCTCCTGG + Intronic
1010293440 6:74167203-74167225 GCTCCTGCTGCTCCATTCCCAGG - Intergenic
1010916257 6:81622917-81622939 GCTCCCACGGCCAGAGTTCCAGG - Intronic
1012709457 6:102581503-102581525 GCTCCCACTCCGCCAGTTCCTGG - Intergenic
1012996604 6:105981563-105981585 GTTCCCGGAGTCCCAGTTCCCGG + Intergenic
1015521930 6:134140141-134140163 GCTCCTGCTGTCCCCGTCCCAGG - Intergenic
1015773647 6:136792676-136792698 GCTGCCGCTGCTGCTGTTCCGGG - Intergenic
1016445678 6:144129746-144129768 GCTCCCGTTGCCTCAGGTCTTGG + Intergenic
1017198749 6:151730069-151730091 TCTCCCACTGGCCCATTTCCGGG + Intronic
1018391769 6:163346466-163346488 GTTCCCGCTCCCTCAGTGCCAGG + Intergenic
1018617577 6:165702597-165702619 CCACCCGCTGCCACTGTTCCTGG - Intronic
1019361936 7:609128-609150 GCTGCCCCAGCCCCAGTCCCGGG + Intronic
1019486268 7:1290831-1290853 GCTCCTGCACCCCCATTTCCAGG + Intergenic
1019529720 7:1497308-1497330 CCTCTCTCTGCCCCAGTTCCTGG - Exonic
1019625630 7:2014387-2014409 GACCCCGCCTCCCCAGTTCCCGG - Intronic
1022720983 7:32942147-32942169 GCTCCCGTGGCTCCAGTTCAAGG - Intergenic
1022856627 7:34321359-34321381 GCGCCCGCAGCCCCAGGCCCTGG + Intergenic
1023883395 7:44334492-44334514 CCTCCCCCTACCCCAGGTCCTGG + Intronic
1024209327 7:47190346-47190368 ACTCCCCCTGCCCCACTTCTAGG - Intergenic
1025185516 7:56855210-56855232 GCCTCAGCTGCCCCAGTACCTGG + Intergenic
1025686416 7:63721743-63721765 GCCTCAGCTGCCCCAGTACCTGG - Intergenic
1029112762 7:98222208-98222230 GCTCCAGCTGCCCCATTACCAGG + Intronic
1029378982 7:100200301-100200323 CCCCCTGCTGCCCCAGCTCCTGG + Exonic
1029445875 7:100612614-100612636 GCTCCCGCAGACCCAGGCCCAGG - Exonic
1029459725 7:100687754-100687776 GCTCCCGCAGCCTCAGCTCCTGG + Intronic
1030097261 7:105911364-105911386 CCTCCCCTTCCCCCAGTTCCTGG - Intronic
1031144370 7:117981468-117981490 TCTCCATCTGCCCCAGTTCCTGG + Intergenic
1031886612 7:127251725-127251747 GCTGGCGCGGCCCCAGTTTCGGG - Intronic
1031905931 7:127459342-127459364 TCACCCCCTCCCCCAGTTCCAGG + Intergenic
1032059917 7:128715768-128715790 TCTCACTCTGCCCCAGTTTCAGG - Intronic
1033228830 7:139581275-139581297 GCTCCTGGTGTCCCATTTCCAGG - Intronic
1035623010 8:1048712-1048734 CCCACCGCAGCCCCAGTTCCAGG - Intergenic
1035714366 8:1742725-1742747 ACTCCTGCTGTCCCAGTCCCAGG + Intergenic
1036802546 8:11803007-11803029 GCGCCCCTTGCCCCAGATCCGGG - Intronic
1037401678 8:18500463-18500485 GCTTCCACTCCCCCACTTCCAGG - Intergenic
1037502541 8:19499607-19499629 GCTCCATCTGCCCCAGTCCATGG + Intronic
1037755830 8:21709602-21709624 TCTCCCACTGCCCCAGTCCCTGG - Intronic
1038372964 8:27011569-27011591 GTGCTCCCTGCCCCAGTTCCGGG - Intergenic
1038675959 8:29623131-29623153 CCTCCCCCTGCCCCATTCCCTGG - Intergenic
1038797541 8:30723123-30723145 GCTCCCTTTGCCCCAGGGCCTGG - Intronic
1038883517 8:31639702-31639724 GCTGCCGCCGCCTCAGTTACAGG - Intronic
1039755391 8:40517140-40517162 GCTCTTGCTGCCCCTGTTCTAGG + Intergenic
1042175907 8:66036874-66036896 GGTCCCCCTGCCCCAGGCCCTGG - Intronic
1042494794 8:69443931-69443953 CCTCCCCCTCCCCCAGTTGCTGG + Intergenic
1042506933 8:69570854-69570876 TGTCCCAGTGCCCCAGTTCCAGG - Intronic
1042532817 8:69832777-69832799 GCGCCCCCAGCCCCAGTCCCAGG - Exonic
1045362849 8:101449025-101449047 TCTCCCCCAGCCCCAGATCCAGG - Intergenic
1049264614 8:141660782-141660804 GCTTCTGGGGCCCCAGTTCCAGG + Intergenic
1049351448 8:142166951-142166973 CCTCACTCTGCCCCAGCTCCTGG - Intergenic
1049354336 8:142180118-142180140 CCTCCTGCTGCCCGAGTCCCAGG - Intergenic
1049501926 8:142971608-142971630 TCTCCCTCTGCCCCAGGCCCGGG + Intergenic
1049675892 8:143888868-143888890 GCACACGCTGCCCCAGATCCTGG - Intergenic
1049762351 8:144337098-144337120 CCTCCCCCTCCCCCAGCTCCTGG - Intergenic
1052413376 9:28148766-28148788 GTGCTCCCTGCCCCAGTTCCAGG + Intronic
1053503701 9:38622030-38622052 GCTCCCGCGGCCCCAGGACCAGG + Intergenic
1056020229 9:82432330-82432352 GTGCTCCCTGCCCCAGTTCCGGG - Intergenic
1056182768 9:84102015-84102037 GCTCCCCCCGCCCCTGTGCCGGG + Intergenic
1056576375 9:87858482-87858504 GTGCTCCCTGCCCCAGTTCCAGG - Intergenic
1057071667 9:92104981-92105003 GTGCTCCCTGCCCCAGTTCCGGG + Intronic
1057073193 9:92118287-92118309 GCCCCAGCTGCCCCAGTCCCTGG + Intergenic
1059455696 9:114398636-114398658 GCTCCCTATGTCCGAGTTCCTGG - Intergenic
1059728285 9:117030375-117030397 CAACCCTCTGCCCCAGTTCCTGG + Intronic
1060212444 9:121718885-121718907 GCTCCCCCTCCCCCAGTCCTAGG + Intronic
1060228182 9:121808887-121808909 CCTCCCCCTGCCCCAGGTCCTGG + Intergenic
1060480805 9:124015891-124015913 TCCTTCGCTGCCCCAGTTCCCGG - Intronic
1060929395 9:127479421-127479443 GCTCCCGCTGCCCCAGTTCCAGG - Exonic
1061245808 9:129400875-129400897 GCTCTCGCTTCCCACGTTCCCGG + Intergenic
1061499171 9:130992366-130992388 GCTCCGGCTGCCCTAGGGCCTGG - Intergenic
1061580208 9:131531535-131531557 GCTGCCTCTGCGCCAGTCCCGGG + Intergenic
1062162153 9:135086752-135086774 GCGCACGCTGCCCCTCTTCCCGG - Intronic
1062498138 9:136841217-136841239 GCTCCCGCTGCCCCGGGCCCAGG + Intronic
1185807038 X:3067583-3067605 ACTCCTGCTGCCCCAAGTCCTGG - Intronic
1192333145 X:70195793-70195815 TTTCCCTCTGCCCCAGCTCCTGG - Intronic
1192763132 X:74117909-74117931 ACTGCCTCTGCGCCAGTTCCAGG - Intergenic
1193541495 X:82778227-82778249 TCCCCCTCTCCCCCAGTTCCTGG + Intergenic
1197929028 X:131677015-131677037 GCTTCTACTGTCCCAGTTCCAGG + Intergenic
1198429698 X:136553237-136553259 GATCCTGCTCCCCCACTTCCTGG + Intronic
1199471447 X:148199924-148199946 TGTCCCTCTGCTCCAGTTCCTGG - Intergenic