ID: 1060929395

View in Genome Browser
Species Human (GRCh38)
Location 9:127479421-127479443
Sequence GCTCCCGCTGCCCCAGTTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 371}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060929395_1060929399 13 Left 1060929395 9:127479421-127479443 CCTGGAACTGGGGCAGCGGGAGC 0: 1
1: 0
2: 0
3: 42
4: 371
Right 1060929399 9:127479457-127479479 TCAGCAGAGCAGCAGCCAGAAGG 0: 1
1: 1
2: 2
3: 34
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060929395 Original CRISPR GCTCCCGCTGCCCCAGTTCC AGG (reversed) Exonic