ID: 1060929957

View in Genome Browser
Species Human (GRCh38)
Location 9:127483091-127483113
Sequence CTCTGTTGGCCATGCATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060929947_1060929957 12 Left 1060929947 9:127483056-127483078 CCTGCTGGCTGGGCTGGCAGGGT 0: 1
1: 0
2: 3
3: 67
4: 467
Right 1060929957 9:127483091-127483113 CTCTGTTGGCCATGCATGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060929957 Original CRISPR CTCTGTTGGCCATGCATGGA GGG Intronic
900207183 1:1436552-1436574 CTCTGAAAGCCATGCCTGGAGGG + Intronic
901178324 1:7321402-7321424 CTCTGCTGGCCAGGGATGGAGGG - Intronic
905898068 1:41561889-41561911 CTTTGGTGGCCATGTGTGGACGG - Intronic
907105424 1:51878457-51878479 CTATTCTGGCCATGCCTGGAAGG - Exonic
907782539 1:57580359-57580381 GTCGGTTGGCCAGACATGGATGG - Intronic
908469802 1:64432597-64432619 CTCTGTTTACCAGGCCTGGAGGG + Intergenic
910779437 1:90913008-90913030 CTCTGTTGCCCCAGTATGGAGGG + Intergenic
912213104 1:107576705-107576727 CATTGTTGGCCATCCTTGGATGG - Intronic
912578549 1:110698969-110698991 ATCAGTTGGCCATGAATGCATGG - Intergenic
916469702 1:165111218-165111240 TAATGTTGGCCATGCATTGATGG + Intergenic
920390339 1:205596328-205596350 CTCTGGTCCCCATGCCTGGATGG - Intronic
920573189 1:207033444-207033466 CTCTTTTGGCTGTTCATGGAAGG + Intronic
921200473 1:212800460-212800482 TTCTGCTGCCCCTGCATGGAGGG + Intronic
923925220 1:238619297-238619319 CTCTGTGTGCCATGAAGGGATGG + Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924397688 1:243640753-243640775 CTCTGTTGGTCTTGCATGCATGG - Intronic
1063435035 10:6022539-6022561 CTCTGTTGGGTATGCAGGGTTGG - Intronic
1064612643 10:17119317-17119339 CTGAGCTTGCCATGCATGGATGG - Intronic
1066339472 10:34516388-34516410 TTCTGTTAGCCATTCTTGGAAGG - Intronic
1069554613 10:69389628-69389650 CTCTATGGGCCTTGTATGGAGGG + Intronic
1069838174 10:71322503-71322525 CTCTGTTGCCCTTGCATGGTTGG + Intronic
1069949828 10:72011130-72011152 TTCTGGTGTCCATGCATGAACGG - Exonic
1070421127 10:76238440-76238462 CTCTGTTGCCCTTACATTGAAGG + Intronic
1071388844 10:85149581-85149603 CTCAGTTTGCCGTCCATGGATGG - Intergenic
1071430415 10:85602397-85602419 CTGTGTTTGCACTGCATGGAGGG + Exonic
1073292114 10:102418573-102418595 CTCTGGTGGCAATGCAGGGGAGG + Intronic
1073338458 10:102727921-102727943 CAGGGTTGGCCATGTATGGAAGG + Intronic
1078634404 11:13035386-13035408 CTGTGTTGGCCATGTGTGGAGGG + Intergenic
1079551031 11:21697474-21697496 CTCTGTTGCCCAGGCTGGGATGG - Intergenic
1082814108 11:57497033-57497055 TTCTGGTGGGCAGGCATGGAGGG - Intronic
1082835180 11:57646196-57646218 CTCTTTGGACCATGCAAGGAAGG + Intronic
1083163820 11:60871532-60871554 CCCTGCAGGCCAGGCATGGAAGG - Intronic
1084744140 11:71156929-71156951 CTCAGTGGGCCATGCATTGTAGG - Intronic
1085451206 11:76635030-76635052 TTTTCTTGGCCATGCTTGGAGGG + Intergenic
1086974049 11:93113158-93113180 CTCAGGTGGCCCTGCTTGGAGGG - Intergenic
1090953335 11:131493461-131493483 CTCTGGTGGCCATTCATAAAGGG + Intronic
1091771167 12:3152227-3152249 CCCTGGTGGCCAGGCAAGGAGGG - Intronic
1092650990 12:10634635-10634657 CTCTGTGGGCCTAGCAGGGAAGG - Exonic
1094463805 12:30728859-30728881 TTCTGTTCGCTCTGCATGGAAGG + Exonic
1095175589 12:39088675-39088697 TTCTGTAGGCCATGCAAGCATGG + Intergenic
1099234370 12:80065501-80065523 CTCACTTGGACATTCATGGAGGG + Intergenic
1099359334 12:81680509-81680531 CTATGTTGGCGATGCAGGTAAGG + Intronic
1102368926 12:112364695-112364717 CTTTGTTGTCCATGGCTGGAGGG - Intronic
1102571084 12:113827453-113827475 CGCTGTCGGCCCTGCATGGGAGG + Intronic
1102741976 12:115216198-115216220 CTCTGTTCTTCCTGCATGGATGG - Intergenic
1103126188 12:118424392-118424414 TTCTGTTGGCCTTCCCTGGATGG - Intergenic
1104481797 12:129114096-129114118 ATCAGTTGTCCATGCATAGAAGG + Intronic
1106079474 13:26488296-26488318 CTCTAGTGGCCTTGCAAGGAGGG - Intergenic
1107438301 13:40401643-40401665 CTGTCTTGGCCATTCAGGGAAGG + Intergenic
1107753746 13:43597308-43597330 CTTTCTTGGCCATGGATGGTAGG - Intronic
1111122964 13:83878972-83878994 CCCTGTTGGCTACGCAGGGATGG - Exonic
1114390509 14:22303091-22303113 CTCTGTGGACCATTGATGGAGGG - Intergenic
1114532569 14:23404897-23404919 CTCTGATGGCCAGGCTGGGAAGG - Intronic
1114720052 14:24871956-24871978 CTCTGTTGGCCATGGAGGTCTGG - Intronic
1118009855 14:61599605-61599627 CTCTGAGGGCTATGGATGGAAGG - Intronic
1125020235 15:34977741-34977763 CTCTGTCACCCAGGCATGGAAGG + Intergenic
1125118322 15:36121727-36121749 CTCTGTTGCCTTTGCCTGGAAGG - Intergenic
1129281871 15:74491726-74491748 ACCTGCTGGCCATGCATGGTGGG - Intergenic
1129325943 15:74800334-74800356 CTCTGGTGGTCAGGCCTGGACGG + Intronic
1134483504 16:14638347-14638369 CTCTGTTGCCCAGGCCTGGAGGG - Intronic
1135021856 16:18969466-18969488 CTCTGGTGGCCACGTGTGGAAGG + Intergenic
1137572743 16:49577537-49577559 CTCTTTTGACCCTGCTTGGAGGG - Intronic
1137587356 16:49671533-49671555 CACTCTTGGCCATGCAGGGCGGG - Intronic
1138184044 16:54962913-54962935 CTGTGGTGGCCATGGGTGGAGGG + Intergenic
1138260065 16:55612385-55612407 CTCTGTTGGACATGGCTGAATGG + Intergenic
1139679383 16:68549292-68549314 CTAAATTGTCCATGCATGGAGGG - Intronic
1139710516 16:68772272-68772294 CTCTTCGTGCCATGCATGGAAGG + Intronic
1141935247 16:87234110-87234132 TTCTGCTGGCCTTGCATGGGAGG - Intronic
1145053554 17:19682748-19682770 CACTGTTTGCCATGCATGGTAGG - Intronic
1147305064 17:39557486-39557508 CTCTCTTGACCTTTCATGGAGGG + Intronic
1148837143 17:50471297-50471319 CTCTGTGGGCTAAGCATGAAAGG + Intronic
1150019235 17:61593839-61593861 CTTTTTTGGCCATGCACAGAAGG + Intergenic
1150508412 17:65722533-65722555 CTCTACTGGCCAGGCATGGTGGG - Intronic
1151345268 17:73497584-73497606 CTCTGCTGGCCATGCAGGAGAGG - Intronic
1153449863 18:5215300-5215322 CTCTGTTGTCCAGGCTGGGAAGG - Intergenic
1154342427 18:13514987-13515009 CACTGTGGGCAAAGCATGGAAGG + Intronic
1156473242 18:37390479-37390501 CTCTGCTGGGCATGCAGGGCTGG + Intronic
1156475449 18:37402925-37402947 CTGTTCAGGCCATGCATGGAGGG - Intronic
1158257614 18:55570846-55570868 CTCTGTTGCTCAGGCTTGGAGGG - Intronic
1161219992 19:3114042-3114064 CTCTGCCTGCCAAGCATGGAGGG - Intronic
1161359686 19:3840903-3840925 TTTTGATGGCCATGCATGGCTGG + Intronic
1163347062 19:16749971-16749993 CTCTGTCCGCCATGCTCGGAGGG + Exonic
1168641190 19:58033007-58033029 CTCTGTTGCCCAGGCAAGGCTGG + Intergenic
925008878 2:467412-467434 CTCTGTGGCCCCTGCATGGGTGG + Intergenic
928611634 2:32997467-32997489 CTCTGTTGGCCAGGCTGGAACGG - Intronic
929881150 2:45838263-45838285 CTCAGTTGGCCAGGCAGGGCTGG + Intronic
931018913 2:58020243-58020265 CTCTGTTGTCCCGGCCTGGAGGG + Intronic
932805381 2:74778564-74778586 CTCTGTGGGCCTTGGAAGGAGGG - Intergenic
935038797 2:99405395-99405417 CTCTGCTCCCCCTGCATGGAAGG - Intronic
936083670 2:109452522-109452544 CTCTCTGGTACATGCATGGAAGG - Intronic
936557969 2:113512278-113512300 CTCTGTTGCCCATGCTTTGCTGG + Intergenic
937884033 2:126888045-126888067 TCCTGTGGGCCATGGATGGAGGG - Intergenic
940277623 2:151955866-151955888 CTCTGTTGGCCCAGGATGGAGGG - Intronic
941648499 2:168067578-168067600 CTCAGGTGGCAATGCAAGGATGG + Intronic
943373639 2:187048249-187048271 ATCAGTTGGCCATACATGCATGG + Intergenic
948056910 2:235015533-235015555 CTCTGTGGGGAATGCAAGGATGG + Intronic
1170343863 20:15361364-15361386 ATCGGTTGGCCATACATGTATGG + Intronic
1171945902 20:31377404-31377426 CACTGTTACCCATGCATCGAAGG + Intronic
1175154442 20:56960417-56960439 CTCTGAAGGCCATGCAAGGCAGG + Intergenic
1176028822 20:63000409-63000431 CTCTGAGGGGCATGCATGGAAGG - Intergenic
1176049872 20:63113060-63113082 CTCTTCGGGCCATGCAAGGAAGG + Intergenic
1176195119 20:63833135-63833157 GTCCGTTGTCCATGCAGGGATGG + Intergenic
1176660550 21:9630986-9631008 CTCTGTTGCCCAGGCAGGGATGG - Intergenic
1177915926 21:27088169-27088191 TTTTTTTGGCCAAGCATGGAAGG + Intergenic
1180205058 21:46254683-46254705 CTCAGTTGGAGATGCATGAAGGG + Intronic
1181278459 22:21702254-21702276 GTGTGGTGGCCATGCAGGGAAGG + Intronic
1182148755 22:28013908-28013930 CTCTGTTGGGCAGGCTGGGAAGG + Intronic
1182892312 22:33829343-33829365 CTCTCTGGGCCATGCGTGAAGGG - Intronic
1183455978 22:37923585-37923607 CTCTGTTCTCCATGCTGGGACGG + Intronic
1183768071 22:39897804-39897826 TACTGTTGGCCAGGCATGGTTGG - Intergenic
1183853267 22:40610078-40610100 CCCTGTTGCCCAGGCTTGGAGGG + Intronic
1184209224 22:43025409-43025431 CTGTGCTGGGCATGCAGGGAGGG + Intergenic
949742997 3:7257969-7257991 CCTTGTGGCCCATGCATGGATGG - Intronic
952277683 3:31892985-31893007 CTCTGTTGACCAAGGATGTATGG - Intronic
952758230 3:36891049-36891071 ATCTCTTGGCCAGGCATGGTGGG + Intronic
954936133 3:54328766-54328788 CTCTGCTGGACATGCTTGGAGGG + Intronic
967052686 3:185799364-185799386 CTCTGTTGCCCAGGGATGGAAGG - Intronic
967156206 3:186694847-186694869 TTCTGTGGGCCAGGCCTGGAAGG + Intergenic
968442382 4:630397-630419 CTCTGCTGCCCTTGCATGGATGG - Intronic
968544475 4:1191737-1191759 CTGTGTAGGCCCTGCCTGGAGGG + Intronic
973294560 4:48502509-48502531 CTCTGTTGCCCAGGCTTGGAGGG - Intronic
973720648 4:53720260-53720282 CTCTGGTGGCTATGTTTGGAGGG + Intronic
975536584 4:75457928-75457950 CTCTGTTGGCCTTTCAGAGAGGG + Intergenic
978566246 4:110085270-110085292 CTCTCATGGCTCTGCATGGATGG + Intronic
981663457 4:147194786-147194808 CTCTGCTGGCTTTGCACGGAAGG + Intergenic
984998681 4:185463559-185463581 CCCTCTTGGCCATGTATGAATGG + Intronic
985250167 4:188016056-188016078 CTCTGTTGCCCAGGCAGGGATGG - Intergenic
985414812 4:189725428-189725450 CTCTGTTGCCCAGGCAGGGATGG + Intergenic
986153731 5:5152471-5152493 TTCTGTTGGCCATGCCTGCCTGG + Intronic
988804801 5:34730384-34730406 ATTTATTGGCCAGGCATGGATGG + Intronic
989541446 5:42623456-42623478 ATGTGTTGGGAATGCATGGATGG - Intronic
989802215 5:45556857-45556879 TTCTGTTGGCAATTCAGGGAGGG - Intronic
991520473 5:67491618-67491640 CAATGTTGGCCATGCATACAGGG - Intergenic
996304125 5:122026628-122026650 CTCTGTTGTACTAGCATGGAAGG - Intronic
998041703 5:138954595-138954617 CTCTACTGGCCCTGCCTGGATGG - Intronic
998410895 5:141910391-141910413 CTCTGTTGGCCTGGCCTGGCTGG + Intergenic
1002467143 5:179413246-179413268 GAGTGTTGGCCGTGCATGGAAGG - Intergenic
1002539108 5:179894292-179894314 CTCTGGTGGCCATGTGGGGATGG + Intronic
1006055813 6:31383928-31383950 CTCTGTTGGCCATCTGTGGCTGG - Intergenic
1010149999 6:72720047-72720069 ATCTGTTAGGCATGCATGCAAGG + Intronic
1010744099 6:79541509-79541531 CACTGGTGGCCATACCTGGAAGG - Intergenic
1011281727 6:85684961-85684983 CTCATGTGGCCATGCATGGGTGG - Intergenic
1013984671 6:116176264-116176286 CTCTGTGGTACATGCATGCAGGG - Intronic
1014252765 6:119131450-119131472 GTTTGTTTGCCATGTATGGAGGG + Intronic
1016397587 6:143641973-143641995 AGCTGTTGGCCATGCATGAGTGG - Intronic
1016714922 6:147214388-147214410 TTCTTTTGGCCATGAGTGGAAGG + Intronic
1017373171 6:153736437-153736459 CTCTGTAGCCTATTCATGGAGGG + Intergenic
1019267888 7:129008-129030 CTCCGTTGGCCGTGCTTGGCCGG + Intergenic
1019324850 7:432998-433020 CTCTGGTGGCCCTGCAGGGAGGG - Intergenic
1019355198 7:574982-575004 CTCTGTTGTCTAGGCAAGGAAGG + Intronic
1024863997 7:53881480-53881502 CCCTGTTGGACAGGCATGGAAGG + Intergenic
1024912945 7:54466809-54466831 CTCTGGGGCCCATGGATGGAGGG + Intergenic
1030226802 7:107161866-107161888 CTCTGTTGACCATTCATTCAAGG + Intergenic
1034321037 7:150182140-150182162 ATCTGTTGGTGATGCATGGTTGG - Intergenic
1034673124 7:152872364-152872386 GTCTGGTGGCCATGCAGGAAGGG + Intergenic
1034673180 7:152872552-152872574 GTCTGGTGGCCATGCAGGAAGGG + Intergenic
1035766227 8:2107757-2107779 CTCTGTTGGCCCTGCCTCCAGGG + Intronic
1038604796 8:28989512-28989534 CTCAGTTGGACATGCATGCAAGG + Intronic
1043984046 8:86672707-86672729 ATCTGTGGGCCATGTAGGGAAGG - Intronic
1044595752 8:93956680-93956702 CCCAGTTTGCCATGCAAGGAAGG - Intergenic
1044971754 8:97626688-97626710 CTCTGTTGCCCAGGCTGGGAGGG - Intergenic
1047277752 8:123418411-123418433 CTCTGTTGCCCAGGCAGGAAGGG - Intronic
1048406892 8:134132390-134132412 CAATGTTAGCCATGCAGGGAAGG - Intergenic
1049383444 8:142329204-142329226 CACAGCTGGCCATGCAGGGAGGG + Intronic
1049622982 8:143606890-143606912 CTCTGCTGGCCAGGCTTGGGCGG - Intronic
1049894884 9:103985-104007 CTCTGTTGCCCATGCTTTGCTGG - Intergenic
1050835998 9:10079314-10079336 CACTGTTGGCCACGTATGCAGGG + Intronic
1056824872 9:89869894-89869916 CTCTGTTGTCCAAGCCTGCATGG - Intergenic
1056832575 9:89928912-89928934 CTCTGGTGGACAGGTATGGAGGG - Intergenic
1060929957 9:127483091-127483113 CTCTGTTGGCCATGCATGGAGGG + Intronic
1062229994 9:135476742-135476764 CTCTGCTGTCCATGGGTGGATGG - Intergenic
1203638120 Un_KI270750v1:132830-132852 CTCTGTTGCCCAGGCAGGGATGG - Intergenic
1188944734 X:36285424-36285446 TTCTCTTGGCCATGCAAGGATGG + Intronic
1188984105 X:36754124-36754146 CTCTGCAGGTGATGCATGGAAGG - Intergenic
1189895409 X:45650329-45650351 CTCTGGTGGCAGTACATGGAAGG + Intergenic
1199013426 X:142783315-142783337 CTCTTTTGTCCAAGGATGGAAGG - Intergenic
1199868364 X:151874598-151874620 CCCTTTTGGGCATGTATGGAGGG - Intergenic
1202081100 Y:21085024-21085046 CTCTTTTGGCCCTGCCTGCAGGG + Intergenic
1202167748 Y:22010505-22010527 ATCTGGTGGCCATACATGAAAGG - Intergenic
1202223613 Y:22575864-22575886 ATCTGGTGGCCATACATGAAAGG + Intergenic
1202319503 Y:23619797-23619819 ATCTGGTGGCCATACATGAAAGG - Intergenic
1202551266 Y:26050260-26050282 ATCTGGTGGCCATACATGAAAGG + Intergenic