ID: 1060933126

View in Genome Browser
Species Human (GRCh38)
Location 9:127501192-127501214
Sequence CCTCAAATTCTGCAGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 171}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060933115_1060933126 3 Left 1060933115 9:127501166-127501188 CCGCCTGCCCTGCCTGTGGCCAC 0: 1
1: 3
2: 13
3: 132
4: 741
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933116_1060933126 0 Left 1060933116 9:127501169-127501191 CCTGCCCTGCCTGTGGCCACCCT 0: 1
1: 2
2: 10
3: 97
4: 774
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933110_1060933126 9 Left 1060933110 9:127501160-127501182 CCCCACCCGCCTGCCCTGCCTGT 0: 1
1: 2
2: 12
3: 83
4: 627
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933117_1060933126 -4 Left 1060933117 9:127501173-127501195 CCCTGCCTGTGGCCACCCTCCTC 0: 1
1: 0
2: 8
3: 77
4: 595
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933114_1060933126 4 Left 1060933114 9:127501165-127501187 CCCGCCTGCCCTGCCTGTGGCCA 0: 1
1: 0
2: 10
3: 96
4: 739
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933107_1060933126 19 Left 1060933107 9:127501150-127501172 CCGGGGCCCTCCCCACCCGCCTG 0: 1
1: 0
2: 6
3: 121
4: 818
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933109_1060933126 12 Left 1060933109 9:127501157-127501179 CCTCCCCACCCGCCTGCCCTGCC 0: 1
1: 3
2: 26
3: 241
4: 1951
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933108_1060933126 13 Left 1060933108 9:127501156-127501178 CCCTCCCCACCCGCCTGCCCTGC 0: 1
1: 0
2: 22
3: 162
4: 1451
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933111_1060933126 8 Left 1060933111 9:127501161-127501183 CCCACCCGCCTGCCCTGCCTGTG 0: 1
1: 1
2: 4
3: 56
4: 496
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933112_1060933126 7 Left 1060933112 9:127501162-127501184 CCACCCGCCTGCCCTGCCTGTGG 0: 1
1: 1
2: 6
3: 78
4: 707
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933119_1060933126 -9 Left 1060933119 9:127501178-127501200 CCTGTGGCCACCCTCCTCAAATT 0: 1
1: 0
2: 1
3: 10
4: 150
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171
1060933118_1060933126 -5 Left 1060933118 9:127501174-127501196 CCTGCCTGTGGCCACCCTCCTCA 0: 1
1: 0
2: 4
3: 47
4: 470
Right 1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG 0: 1
1: 0
2: 3
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060933126 Original CRISPR CCTCAAATTCTGCAGGTACA GGG Intronic
902198773 1:14818451-14818473 CCTCTACTTCTTCAGGGACAAGG + Intronic
905718506 1:40175105-40175127 CCTCAAACTCTTCAGCTTCAGGG - Intronic
909996322 1:82284375-82284397 CCCCAAATGCTGGAGTTACAGGG + Intergenic
920228940 1:204457720-204457742 CCTAAAATTCAGAAGGTAAAGGG - Exonic
920258013 1:204669576-204669598 GGTAAAATTCTGAAGGTACAGGG + Intronic
920261727 1:204692912-204692934 CCTCAGGTTCTGCAAGTACAGGG - Intergenic
921105470 1:211972787-211972809 CCACAAGTTCTTCAGGTGCAAGG + Intronic
921406147 1:214781545-214781567 CCTCAAATTCTACAGGAAGCTGG - Intergenic
1063676080 10:8141513-8141535 CCTCACCTTGTCCAGGTACAAGG - Intergenic
1071752121 10:88491748-88491770 CCACATATTCTGCAGATACTTGG - Intronic
1071758463 10:88572917-88572939 CCTGAGATTCTGCAGCTTCAAGG - Exonic
1072706443 10:97684456-97684478 CCTCAAAATCTGGAGGTGCTAGG - Intronic
1073863300 10:107771394-107771416 CCTCCAATGCTGCAGGTTCCTGG + Intergenic
1078091611 11:8267948-8267970 CCACAGATCCTGCAGGTGCAGGG - Intronic
1079253185 11:18802772-18802794 TCTCAGATTCTGCAGGTCCCCGG + Intergenic
1080047062 11:27820635-27820657 CCTAGATTTCTGCAGATACATGG - Intergenic
1080639632 11:34151327-34151349 CCTCGAATTCTGCAGGCCCTGGG - Exonic
1081564701 11:44250818-44250840 CCTGAAAATCAGCAGATACAGGG - Intergenic
1083830943 11:65233182-65233204 CCCAAACTTCTGCAGGTCCATGG - Intergenic
1085186387 11:74579393-74579415 CCTGAAATAGGGCAGGTACAGGG + Intronic
1085501547 11:77029408-77029430 CCTCAAAGTCTGGATGTCCATGG + Intergenic
1086443854 11:86853814-86853836 CGTAAAATTGTGCAGGAACAGGG - Intronic
1087253476 11:95929751-95929773 CCCCAAATTCTGGGGTTACAGGG - Intergenic
1087762763 11:102119779-102119801 CCTCAAAGCCTTAAGGTACAAGG - Intronic
1088692282 11:112338175-112338197 TCTGAAATACTGCAGGTCCAGGG - Intergenic
1089033630 11:115361081-115361103 TCTCAAATTCTGCAAGAGCAGGG + Intronic
1090304813 11:125682183-125682205 CATCACATTCTGCGGGAACAAGG - Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1093416610 12:18927777-18927799 ACTCAAATCCTGCAGCTAAAAGG + Intergenic
1093592595 12:20921625-20921647 TCTGAAATGCTGCAAGTACATGG - Intergenic
1096528595 12:52229513-52229535 CATAAAGTTCAGCAGGTACATGG + Intergenic
1096738512 12:53675230-53675252 CCCCAGATTCTGCTGTTACAAGG - Intronic
1097167740 12:57094598-57094620 CCTCGAACTCTGCAGGGAAAAGG - Exonic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099290210 12:80767542-80767564 CCTCAAATTCTTCAGGGAGATGG + Intergenic
1101445832 12:104736218-104736240 CCCCAGATTCTGTAGGCACAGGG - Intronic
1101867542 12:108532027-108532049 TCTCAAATTCTGCAGCTACAAGG - Intronic
1102146463 12:110658509-110658531 CCTCCAATGCTGCAGGTCCTTGG + Intronic
1102694565 12:114788072-114788094 CCTCAAATTCTTCAGGATCTGGG - Intergenic
1102709627 12:114914743-114914765 CCTCAAGCCCTGCAGATACAAGG - Intergenic
1104456974 12:128923260-128923282 CATAAAATTATGCAGGTTCAAGG - Intronic
1108784705 13:53882032-53882054 CATCAAATTTTGCAGATACATGG + Intergenic
1109470941 13:62802563-62802585 CATCAAATTCTACAGGTTGAGGG - Intergenic
1110835913 13:80082646-80082668 CCTAAAATTCAGCAAGCACAAGG - Intergenic
1110860049 13:80338512-80338534 CCTTAGATTCTGCAGCTAAAAGG + Intronic
1113789684 13:113021741-113021763 CCTCATAACCTGCAGGTACTGGG + Intronic
1115073721 14:29359599-29359621 CCTCAAATTCAGCTCTTACAGGG + Intergenic
1117897423 14:60502175-60502197 ACTCAATTTCTGAAGGTAGATGG - Intronic
1118001446 14:61527149-61527171 CCTCAAGGTCGGCAGGAACATGG - Intronic
1119976572 14:79030590-79030612 CCTCAAATTGTACAGGTACATGG + Intronic
1130555727 15:84921192-84921214 CATCAAATTCTGCTGCTCCAGGG + Intronic
1132008981 15:98257505-98257527 CCTCAAATTCAGAAGGGAAATGG - Intergenic
1132035062 15:98475838-98475860 CCACCAACTTTGCAGGTACAGGG + Intronic
1139818141 16:69693945-69693967 CCTCAGATTCAGTTGGTACAAGG + Exonic
1144070363 17:11666209-11666231 CCTCTAATGCTGGAGGTTCAGGG + Intronic
1144132961 17:12265830-12265852 CCTCCATTTCTTCAGGTCCATGG - Intergenic
1146922642 17:36723494-36723516 CCTCAGAGTCTGCAGGAGCAGGG + Intergenic
1147544681 17:41392060-41392082 CTTCAAATCCTGCAAGGACAAGG + Intronic
1151563347 17:74882803-74882825 CCTCAAACCCTGCATGTCCAGGG + Intronic
1151607097 17:75144720-75144742 CCTCAGATTCAGCAGGTTGAGGG - Intronic
1154388471 18:13916682-13916704 CCTCTGCTTCTGCAAGTACAAGG - Intergenic
1155561365 18:27080890-27080912 CCTTAAATTCTTCAGATTCATGG - Intronic
1156644080 18:39138765-39138787 CATCAAATTCTGCTGTTGCAGGG - Intergenic
1158382653 18:56950950-56950972 TCTCAAATTCTGTAGGCTCAGGG + Intronic
1159603969 18:70455882-70455904 CCTCAAATACTGCGAGTACCAGG + Intergenic
1161266927 19:3368401-3368423 CCTCAGTTTCTCCAGGAACAGGG + Intronic
1165042137 19:33076162-33076184 CCTCAACTTCTCCAGGTTCAGGG - Intergenic
1165101298 19:33440171-33440193 CCTCAACTTCCCCAGGCACAAGG + Intronic
1165773264 19:38390284-38390306 CCCCACCTCCTGCAGGTACATGG + Exonic
1165970579 19:39625436-39625458 CCTCACATCCTGCAAGCACAGGG - Intergenic
1165975977 19:39677057-39677079 CCTCACATCCTGCAAGCACAGGG + Intergenic
927428312 2:23005430-23005452 CCTGGAATTCTGAAGGGACATGG + Intergenic
927533952 2:23837308-23837330 CCTCTGATCCTGCAGGGACAGGG + Intronic
927711272 2:25327903-25327925 CCTCACATCCAGCAGGTACCTGG + Intronic
930018880 2:46988974-46988996 CCACACATTGTGCTGGTACAGGG + Intronic
932028341 2:68157799-68157821 CCCCAAATCCTGCAGGTCCCCGG + Exonic
932982707 2:76689132-76689154 ACTGAAATTCTGCAGGTAATGGG + Intergenic
940051106 2:149465891-149465913 TCTCATATTCTGCAACTACATGG - Intronic
942094453 2:172524218-172524240 CCTCAGATTCTCCAAGTACGTGG + Intergenic
943114019 2:183643894-183643916 CTTCAAGTTCTGCAGGCATAAGG - Intergenic
945981596 2:216316744-216316766 CTTCTGATTCTGCAGGTCCAAGG + Intronic
946051269 2:216864409-216864431 CATCCAGTTCTGGAGGTACAGGG + Intergenic
946705512 2:222454985-222455007 CCAGGAATTCTGCAGGAACAAGG + Intronic
947580009 2:231309628-231309650 CCTCGAATTCTGAAGTTGCAAGG - Intronic
947592587 2:231394082-231394104 CCGCAGATTCTGCAGCTCCACGG - Intergenic
948455719 2:238103777-238103799 CCTCAGGCTCTGCAGGTGCAGGG + Intronic
948934411 2:241153312-241153334 CCTCAAATGGTGCTGGGACATGG + Intronic
1169850135 20:10039383-10039405 CCTGAGTTTCTGCAGATACAAGG + Intronic
1169889551 20:10437385-10437407 TCTCAATCTCTGCAGATACAGGG - Intronic
1170348545 20:15414992-15415014 TCTAAACTTCTCCAGGTACAGGG - Intronic
1170708225 20:18765421-18765443 CCTCACAGTATGCAGGAACATGG + Intergenic
1172752171 20:37258552-37258574 CCTCCAGCTCTGCAGGTACAGGG - Intronic
1177862496 21:26470800-26470822 CCTCACATCCTCCAAGTACAGGG - Intronic
1178409380 21:32350906-32350928 CCTCAGCTGCTGCAGGCACAGGG - Exonic
1178810525 21:35877326-35877348 CCCCAACTTCTGCAGGTCCCCGG - Intronic
1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG + Intronic
1179500099 21:41803353-41803375 CCACAAAACCTGCAGGGACAGGG + Intronic
1179949842 21:44703438-44703460 CCTCAAACTCACCAGGGACAGGG - Intronic
952129963 3:30350078-30350100 CCTGAAATTATGCAGAGACAGGG - Intergenic
952201175 3:31129492-31129514 CCTCTAAATCTTCAGGTAAAAGG - Intergenic
952818823 3:37468356-37468378 CCTCCAATTCTTCAGGTTCTAGG + Intronic
952983449 3:38756863-38756885 CCTCAGGGTCTGCAGGTTCAAGG + Exonic
952988541 3:38810439-38810461 CCTCAAATTCTGCTTCTAGATGG + Intergenic
953785651 3:45909277-45909299 CCACCAATGCTGCAGGTCCATGG + Intronic
958871108 3:99560281-99560303 CCTCAGATTATGCAGTTACTTGG - Intergenic
959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG + Intergenic
959902959 3:111680385-111680407 CCTCAAATCCTGTAGGAAAATGG - Intronic
961914340 3:130356103-130356125 CCTCAATTTCTGTCGGTACCTGG - Intronic
962100474 3:132336719-132336741 CCTCAAATTTAACATGTACAAGG - Intronic
963117957 3:141748898-141748920 CCTCAATTTCTTCATGTGCAAGG + Intergenic
964727782 3:159832652-159832674 CTTCAAATACTGCAGGGACGCGG - Intronic
964957898 3:162383781-162383803 CCTCAATTTCTGCTGGTACAGGG - Intergenic
966695059 3:182781026-182781048 CCTCAAATTCTGAAACTAAAGGG - Intergenic
967317742 3:188165190-188165212 CCTCAAATTCTGGAGCTCAAGGG - Intronic
970594377 4:17586564-17586586 CCTCACTTTCTGCAAGGACAAGG - Intronic
970721135 4:18989809-18989831 CTGCAAATTCTGCAGATACCAGG - Intergenic
973749291 4:53997334-53997356 TTTCTAATTCTGCAGCTACATGG - Intronic
974732165 4:65881643-65881665 CTGAAAATTCTGCAGATACATGG + Intergenic
974762607 4:66297633-66297655 CCTCAAATTTTGAATGTAAATGG + Intergenic
977401767 4:96541532-96541554 CATCAGATCCTGCAGGTTCAGGG - Intergenic
977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG + Intergenic
978534491 4:109746706-109746728 CCTCATATTGAGCAGTTACATGG - Intronic
981477200 4:145198882-145198904 CTGCAAATTCTGCAGGTGAAAGG - Intergenic
982092124 4:151889339-151889361 ACTCAGATTCTGCAGGTAGTCGG - Intergenic
984120773 4:175739678-175739700 CCTCAAATTCTTAAGGTTCAGGG + Intronic
984712282 4:182895813-182895835 CATCACACTCTGCAGGCACAGGG - Intronic
985122949 4:186661906-186661928 CCTCAGATTCTGCAGGTTAAGGG - Intronic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
989411433 5:41123721-41123743 CCTCAGCTTCTGCAGGTGCTTGG + Intergenic
993680365 5:90870548-90870570 CCTCAAATTTGGCAAGAACAAGG + Intronic
995576319 5:113539247-113539269 CCTTACATTGTGGAGGTACAAGG + Intronic
995980463 5:118096597-118096619 CAACAAATTCAGCAGGTACTTGG + Intergenic
996792165 5:127304752-127304774 CCTAAAGTTCTGGAGTTACAGGG + Intronic
996952262 5:129141403-129141425 TCTCAAAGTCTGAAAGTACATGG - Intergenic
998686745 5:144535661-144535683 CCTCACATCCTGCAGGGACATGG + Intergenic
1000062975 5:157672365-157672387 CCTCAAGTTCTCCATGGACAGGG - Intronic
1002862960 6:1096111-1096133 CCACAGATTCTGCAGGGCCAGGG - Intergenic
1003207271 6:4024241-4024263 GCTCAAGTGCTGCAGGTACTAGG + Intronic
1003247254 6:4393342-4393364 TCTCCCATTCTGCAGGGACATGG + Intergenic
1005692937 6:28324419-28324441 CCTCAGATGCTGCTGGTTCATGG - Intergenic
1008410130 6:51167826-51167848 CCTTACATTCTGCAGCTGCAGGG - Intergenic
1008479678 6:51972560-51972582 CTACAAAATCTGCACGTACAAGG - Intronic
1008586355 6:52954001-52954023 CCTGTAATTCTGAAGGTATATGG - Intergenic
1013665288 6:112341504-112341526 CCTCAGCTTCTCCAGGTACTGGG - Intergenic
1015130658 6:129804888-129804910 CCTAAGATTCTCCAGGTATATGG + Intergenic
1016889944 6:148995872-148995894 CCTCAGTATCTGCAGGCACAGGG + Intronic
1018533704 6:164796127-164796149 CATCAAAACCTGCAAGTACATGG + Intergenic
1019443137 7:1057416-1057438 CCAGAAGTGCTGCAGGTACAGGG - Intronic
1019777521 7:2921444-2921466 CATCATATTCTGCAGGCCCACGG + Intronic
1022474637 7:30701880-30701902 CCTCAGAGTGTGCAGGGACATGG + Intronic
1022847416 7:34224840-34224862 CCCCAAATTCTGCAAGAACAAGG + Intergenic
1024348610 7:48339148-48339170 CCTCACACTCTGCTTGTACATGG + Intronic
1024444084 7:49455361-49455383 CCTCAAACTGAGCAGGTACGAGG + Intergenic
1027070642 7:75157919-75157941 CCCCGACTTTTGCAGGTACATGG + Intergenic
1029548463 7:101223659-101223681 ACTCAAGTTCTGCAGAGACAAGG - Exonic
1030783989 7:113637382-113637404 CCCCATATTCAGCTGGTACACGG + Intergenic
1031687907 7:124754896-124754918 CCTGAAATGCTGCAAGGACAAGG - Intronic
1033081631 7:138304242-138304264 ACTCCAATGCTGGAGGTACAAGG - Intergenic
1034617271 7:152429458-152429480 CTTCAAATTCTGCAAATAAAGGG + Intronic
1035471223 7:159110139-159110161 CTTAAAATTCAGAAGGTACATGG - Intronic
1035838279 8:2782055-2782077 GCTCTAATCATGCAGGTACAGGG + Intergenic
1036522408 8:9504088-9504110 CCTCAAATTGTCCAGTAACAAGG - Intergenic
1036723261 8:11198257-11198279 CTTGAAATACTGCAGGAACATGG - Intronic
1039600703 8:38834597-38834619 CCCCAAATGCTGCTGGAACATGG + Intronic
1043793655 8:84507152-84507174 CAACAAATTCTGCAGTTACTAGG + Intronic
1044252629 8:90022061-90022083 CCCCAAATTATTCAGGGACAGGG - Intronic
1045620444 8:103971278-103971300 ACTCAAATTATGCAGTCACATGG - Intronic
1046013296 8:108575852-108575874 CCTCAGATTCTGGAGCTATAAGG + Intergenic
1046922086 8:119741831-119741853 CCTCAAATTCTCAAGGAACAGGG - Intronic
1056975530 9:91249759-91249781 CCTCAGCTTCTGCAAGTACTGGG - Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057488172 9:95502298-95502320 CCAAACATTCAGCAGGTACACGG - Intronic
1060924698 9:127448033-127448055 CCTCACAATCTGCAGATACTGGG + Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1061741417 9:132708942-132708964 CCTCAAAATCTGCAGGCTGAAGG + Intergenic
1061874130 9:133535477-133535499 CCTGAAAATCTGCAGGTGCCGGG + Intronic
1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG + Intergenic
1187288090 X:17925521-17925543 CCTCAGATTCTGCAGGTTCTTGG + Intergenic
1189952727 X:46248901-46248923 CCTCAAGGTCTGAAGGGACAAGG - Intergenic
1190576978 X:51849874-51849896 CATCAAATTCTGGCGGTATAAGG - Intronic
1191714462 X:64184783-64184805 CCTCAATTTCTGCAAGTATGTGG - Intergenic
1192791612 X:74387546-74387568 CCTCAAATTTTGGAAGTTCATGG - Intergenic
1193396449 X:80989584-80989606 CCTCAGATTCTGAAGTGACAAGG - Intergenic
1194141511 X:90215861-90215883 CACCACATTCTGCCGGTACAAGG - Intergenic
1196110238 X:111939072-111939094 CCTAAAACTCTGCATGTACAAGG - Intronic
1198927757 X:141818066-141818088 CAACAAATTCTCCAGGTACTTGG - Intergenic
1199194251 X:145008318-145008340 CATCAAATTCTGCAGTTTCTTGG - Intergenic
1201861582 Y:18603671-18603693 CCTCTGATTCTCCAGGCACAAGG - Intergenic
1201871741 Y:18716709-18716731 CCTCTGATTCTCCAGGCACAAGG + Intergenic