ID: 1060934136

View in Genome Browser
Species Human (GRCh38)
Location 9:127506037-127506059
Sequence CTGTGGGCCAGGCGGGCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 581}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060934123_1060934136 11 Left 1060934123 9:127506003-127506025 CCAACCACCAGAGGGACAGGGAC 0: 1
1: 0
2: 3
3: 19
4: 214
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934124_1060934136 7 Left 1060934124 9:127506007-127506029 CCACCAGAGGGACAGGGACCAGA 0: 1
1: 0
2: 1
3: 37
4: 346
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934118_1060934136 17 Left 1060934118 9:127505997-127506019 CCATCCCCAACCACCAGAGGGAC 0: 1
1: 0
2: 1
3: 25
4: 254
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934120_1060934136 13 Left 1060934120 9:127506001-127506023 CCCCAACCACCAGAGGGACAGGG 0: 1
1: 0
2: 2
3: 28
4: 313
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934122_1060934136 12 Left 1060934122 9:127506002-127506024 CCCAACCACCAGAGGGACAGGGA 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934114_1060934136 30 Left 1060934114 9:127505984-127506006 CCTTGCTGCCGCTCCATCCCCAA 0: 1
1: 0
2: 3
3: 33
4: 292
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934126_1060934136 4 Left 1060934126 9:127506010-127506032 CCAGAGGGACAGGGACCAGAGGG 0: 1
1: 0
2: 2
3: 33
4: 494
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581
1060934115_1060934136 22 Left 1060934115 9:127505992-127506014 CCGCTCCATCCCCAACCACCAGA 0: 1
1: 0
2: 6
3: 80
4: 645
Right 1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG 0: 1
1: 0
2: 7
3: 75
4: 581

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060934136 Original CRISPR CTGTGGGCCAGGCGGGCAGG AGG Exonic
900140203 1:1136666-1136688 CTGTGTGCCAGGCGGCCCGCAGG - Intergenic
900291794 1:1926800-1926822 CTGGGGCCTGGGCGGGCAGGGGG - Intronic
900340202 1:2184899-2184921 CTGTGGGCAAAGGTGGCAGGGGG - Intronic
900341856 1:2193416-2193438 CTGTGGGCAGGGCAGGCTGGGGG - Intronic
900404640 1:2487093-2487115 CTGTGTGGCATGGGGGCAGGTGG + Intronic
900414223 1:2527746-2527768 CCATGGGCCAGGCTGGCAGGAGG + Intergenic
900464863 1:2820679-2820701 CAGGGGGCCAGGGGGCCAGGGGG + Intergenic
900513850 1:3072235-3072257 TTGTGAGCCAGGTGGGCAGGTGG + Intronic
900561642 1:3309970-3309992 CTGTGGGTCAGGCTCGCATGGGG - Intronic
900571692 1:3361795-3361817 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571699 1:3361828-3361850 CTGTGGCCCAGGAGGGCAGGTGG + Intronic
900571717 1:3361898-3361920 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571725 1:3361931-3361953 CCGCGGCCCAGGAGGGCAGGTGG + Intronic
900571734 1:3361964-3361986 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900571743 1:3361997-3362019 CCGTGGCCCAGGAGGGCAGGTGG + Intronic
900592935 1:3467895-3467917 CCGTGGGCGTGGCGGGCAGCGGG + Intronic
900779983 1:4611818-4611840 CTGAGGGCAAGGCCGGGAGGGGG - Intergenic
900798689 1:4724696-4724718 CTGTGGGCCAGGCAGGGTGCTGG - Intronic
900952861 1:5867746-5867768 ATGTGTGCCAGGGCGGCAGGCGG + Exonic
901489336 1:9588830-9588852 CAGGCGGGCAGGCGGGCAGGAGG - Intergenic
901489339 1:9588838-9588860 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
901686827 1:10947891-10947913 CTGTGGGCCAGGAGGAGTGGGGG - Exonic
901985731 1:13073990-13074012 AGGTGGGCCAGGTGGGCTGGTGG + Intronic
901996078 1:13152777-13152799 AGGTGGGCCAGGTGGGCTGGTGG - Intergenic
902309620 1:15571940-15571962 ATGTTGGCCAGGCTGGCAGCTGG - Intronic
902412119 1:16217692-16217714 CTCTGGGCCAGGTGGGCATGGGG + Intergenic
902513423 1:16978087-16978109 CTGTGGTCCAAGCAGGCAGAAGG + Intronic
902615129 1:17619448-17619470 CTGTGGGGGAGTGGGGCAGGTGG + Intronic
902775360 1:18671124-18671146 CTGTGGGGCAGGAAGGCAGCAGG + Intronic
902888860 1:19426759-19426781 CTGTGGGTCAGGAGTTCAGGAGG - Intronic
903792982 1:25906827-25906849 CTTGGGGCGAGGCGGGCATGTGG - Intronic
904355269 1:29934501-29934523 CTGTGGGCAGGGCTGGGAGGAGG + Intergenic
905254470 1:36671310-36671332 CTCTGGGCCAGTGGGGCAGCAGG - Intergenic
905824475 1:41018072-41018094 GTGTAGGCCAGGTGGGCAGCGGG + Exonic
905887983 1:41501959-41501981 CCCTGGGGCGGGCGGGCAGGCGG - Intergenic
906077846 1:43065253-43065275 GTCTGGGCCAGGCTGGCAGCAGG - Intergenic
907564490 1:55422199-55422221 CTGTGGGCCATGCCTGCAGGTGG - Intergenic
908253795 1:62286015-62286037 CTGTTTGCCAGGTCGGCAGGAGG - Intronic
910773224 1:90850979-90851001 CTGGGGCCCAGGCCGGCAGCGGG + Intergenic
912314779 1:108657916-108657938 CTGTGGTCCAAGTAGGCAGGAGG + Intronic
912554961 1:110509182-110509204 CTGTGGGCCAGGAGCGTATGGGG + Intergenic
912977854 1:114346259-114346281 CCCTGGGCCAGGAGGGAAGGGGG - Intergenic
914702818 1:150149944-150149966 CGCTGGGCCGGGCGGGCGGGTGG + Intronic
915113444 1:153579613-153579635 CTGTGGCCCAGGCTGGAATGCGG - Intergenic
915240551 1:154518047-154518069 CTTTGTGCCAGACAGGCAGGAGG - Intronic
916792534 1:168136778-168136800 CGGTGGCCGAGGCGGGGAGGCGG - Intronic
917001568 1:170367112-170367134 CTGTGGGCAAGGCATGCGGGTGG + Intergenic
917630629 1:176888076-176888098 CTGTGGGAGAGGCGCACAGGTGG + Exonic
917739948 1:177952404-177952426 CTGTGGGCTTGGCGTGGAGGAGG - Intronic
918211022 1:182350663-182350685 CTGTTGCCCAGGCTGGAAGGCGG - Intergenic
919464051 1:197910935-197910957 TTGTGGGTCAGGCGTGGAGGCGG + Intergenic
919525071 1:198636796-198636818 CTGAGGTCCAGGCTGTCAGGAGG - Intergenic
919729079 1:200901494-200901516 CTGTGGGCCTGGAGGGCAGCGGG - Intronic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922790523 1:228308482-228308504 CTGGGGGCCTGGCAGGGAGGTGG + Intronic
922929490 1:229377593-229377615 TGGTTGGCCAGGCGGGCAGAGGG - Intergenic
923336991 1:232979347-232979369 CTGTGGACAAGTCGGGCATGTGG + Exonic
924415050 1:243849991-243850013 GTGGAGGCCAGGCGGGGAGGGGG + Intronic
924779162 1:247131201-247131223 CTGAGAGCCAGGCGGGGAAGGGG + Intronic
1062929774 10:1345097-1345119 GTGTGAGCCAGGAGGGCACGTGG + Intronic
1063949502 10:11208800-11208822 CTGAGAGACAGGAGGGCAGGAGG + Intronic
1063997722 10:11636831-11636853 CTGTGGGCCAGGCCTGGAAGTGG + Intergenic
1065099705 10:22321191-22321213 CTGTGGGGGAGGCGGGCGGGCGG - Exonic
1065764548 10:29015645-29015667 CTGTAGGCCTGGGAGGCAGGGGG - Intergenic
1066745815 10:38603795-38603817 CTGGGGGCCAGCCGGGGAGCTGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067513087 10:46911516-46911538 CTGGGGGCCAGGTGGGCAGGGGG + Intronic
1067649166 10:48140326-48140348 CTGGGGGCCAGGTGGGCAGGGGG - Intergenic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1069472077 10:68702551-68702573 CTGTCGCCCAGGCAGGCTGGAGG + Intergenic
1069679241 10:70272078-70272100 CTGTCGCCCAGGCTGGCATGCGG - Intronic
1069827406 10:71262568-71262590 CTGTGTGCCAGGCTGGCACTGGG + Intronic
1069842325 10:71347574-71347596 CTGTGGACCAGGCTTGCAGCTGG + Intronic
1069962082 10:72085238-72085260 CTGTAGGCCAGGGAGCCAGGCGG + Intronic
1070363950 10:75717583-75717605 CTGTGGGCCAGGAGGCAAGGAGG + Intronic
1070751263 10:78965318-78965340 CTGGGGGCAGGGCGGGGAGGAGG + Intergenic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071571574 10:86700195-86700217 CTGTGGGGCAGGAGAGCAGCAGG - Intronic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073465642 10:103693252-103693274 CTGGGGGCCGGGCTGGCAGGGGG - Intronic
1073512474 10:104051491-104051513 CTGTGGGCCAGGAGAGCCGCTGG + Exonic
1073867150 10:107818210-107818232 CTGGGGGCCAGGTGGGGAGCAGG + Intergenic
1074479034 10:113801636-113801658 CTTTGGGGCAGGCGGACATGGGG - Intergenic
1074915423 10:117950713-117950735 CTGTGAGCCAGGAGAGCAGATGG + Intergenic
1075079803 10:119375739-119375761 CTGTGGGCATGCCGGGGAGGTGG + Intronic
1076193773 10:128500567-128500589 CTGGGGGGCAGAGGGGCAGGAGG + Intergenic
1076317595 10:129553485-129553507 CTGTGGGCCCGGGGGACACGTGG + Intronic
1076726612 10:132416893-132416915 CTGTGGGCCCTGAGGGAAGGAGG + Intronic
1076908251 10:133373701-133373723 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908254 10:133373709-133373731 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908257 10:133373717-133373739 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908260 10:133373725-133373747 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908263 10:133373733-133373755 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908266 10:133373741-133373763 CCGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076936048 10:133567999-133568021 CTGTGGGCAAGGGAGGAAGGGGG + Intronic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077271889 11:1685343-1685365 CAGAGGGGAAGGCGGGCAGGTGG - Intergenic
1077333326 11:1992921-1992943 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1077913831 11:6597851-6597873 CTGTGGCCCAGGCTGGAATGCGG - Exonic
1078529483 11:12125979-12126001 CTGAGGCCCAGGTGGGTAGGAGG - Intronic
1079165733 11:18041113-18041135 TTGTGGGCAAGGTGGGGAGGAGG - Exonic
1079241678 11:18726360-18726382 CTGAAGGCCAGGCGGGAAGGAGG + Intergenic
1083799555 11:65038651-65038673 CTGGGAGCCAGGAGGGCAGGAGG + Exonic
1083818145 11:65149323-65149345 CTGTGGTCCAGGCAGCCAGCTGG + Intergenic
1083860002 11:65415278-65415300 GTGCGTGCCAGGCTGGCAGGTGG - Intergenic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084007836 11:66332553-66332575 CTGTGGGCCAGGGCCCCAGGGGG + Exonic
1084214414 11:67639772-67639794 CTGTGCGGGAGGAGGGCAGGTGG + Intergenic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084702961 11:70799543-70799565 CTGTGGGCCAGGCCTCCAAGGGG - Intronic
1085345782 11:75767518-75767540 CTGTAGGTCAGGAGGGCAGTGGG - Intronic
1085390916 11:76181753-76181775 CGGGTGGCCTGGCGGGCAGGCGG + Intergenic
1087791364 11:102409625-102409647 GGGAGGCCCAGGCGGGCAGGCGG + Intronic
1088495843 11:110430397-110430419 GTGTGGGCCCGGCGCGCAGAAGG - Intronic
1089045116 11:115494905-115494927 CTCTGGGCCAGGTTGGCAAGTGG - Intronic
1089046090 11:115503501-115503523 CTGTGGGGCGGGCGGGCTGCGGG + Intronic
1090596544 11:128326977-128326999 CTGAGGGGCAGCCGGGCAGAAGG - Intergenic
1090836691 11:130459155-130459177 ATGTTGGCCAGGCTGGTAGGAGG - Intronic
1090919553 11:131195942-131195964 CTAGGTGCCAGGCGGGCACGGGG + Intergenic
1091262425 11:134245264-134245286 GTGTGGGCCAAAAGGGCAGGTGG - Intronic
1202816306 11_KI270721v1_random:48102-48124 CTCAGGGTGAGGCGGGCAGGCGG - Intergenic
1091403703 12:196262-196284 CTGTGGGCCAGGAGGGGAACTGG + Intronic
1091775263 12:3180913-3180935 CTGTGTGCCAGGCGCTTAGGTGG + Intronic
1091891257 12:4056370-4056392 CTGGGGTCCAGGCAGGCAGTTGG + Intergenic
1092035706 12:5332834-5332856 CTGAGGGCCAGGCCTGCATGGGG - Intergenic
1092926715 12:13278600-13278622 CCCTGGGCCAGGCGAGCAGCTGG - Intergenic
1095970829 12:47901093-47901115 TTGTGGGCAAGGGGGGTAGGTGG - Intronic
1096587175 12:52630320-52630342 TGGAGGGCCAGGCGTGCAGGTGG - Intergenic
1096656922 12:53097810-53097832 CTGCGGGCAAGGGGTGCAGGCGG + Exonic
1096700636 12:53380533-53380555 CCGTGGCCGGGGCGGGCAGGGGG - Intronic
1097222828 12:57460853-57460875 CTGTGGGCAAGGAGCTCAGGAGG + Intronic
1098029813 12:66242244-66242266 CGGTGGGCCAGGAGGCGAGGTGG - Intronic
1099429947 12:82571418-82571440 CTGTGGCCCAGGCTGGAATGTGG - Intergenic
1100389906 12:94139282-94139304 CAGTGGGCCAGGGTGGCTGGGGG + Intergenic
1102505455 12:113381623-113381645 CTGTGGCCCAGGTGGGGAAGGGG + Intronic
1102643784 12:114389814-114389836 CGGTGGGGCAGGCTGGGAGGTGG - Intronic
1103320672 12:120091079-120091101 CAGTGGGCCATGAGGGGAGGCGG - Intronic
1103888810 12:124223115-124223137 CTGTGGGCCAGGCGAGCTCCTGG - Intronic
1104348992 12:128028661-128028683 CTGTGGGCAGGGCGGGAATGTGG + Intergenic
1105902135 13:24764383-24764405 CTGGGGGCCAGGTGAGCTGGTGG + Intronic
1106500973 13:30328359-30328381 CCATGGGGCAGGGGGGCAGGGGG - Intergenic
1108741285 13:53341349-53341371 CTGTGGGGCAGACGAGCAGCAGG - Intergenic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1110271207 13:73592763-73592785 TTGTGGGGGAGGTGGGCAGGTGG + Intergenic
1110909606 13:80939902-80939924 CAGTGGGCCAGGCAGGTGGGTGG + Intergenic
1111597419 13:90428726-90428748 CTGAGGGCGAGCCAGGCAGGGGG - Intergenic
1112693840 13:101925924-101925946 CTGTGAGCCAGGAAGGCAGGTGG - Intronic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113837309 13:113336769-113336791 CTGAGCGCCAGGCGGGCACTTGG - Intronic
1114474170 14:22982290-22982312 CAGGGTGCCAGGCGGGGAGGGGG - Exonic
1114890162 14:26910277-26910299 CTATGGGCTGGGCGGGCAGGAGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117949402 14:61066424-61066446 CTGATGGCCAGGTGGGCAGGTGG + Intronic
1118153393 14:63213865-63213887 GTATGGGCCAGGCTGACAGGTGG + Intronic
1119859400 14:77925412-77925434 CTGTGGGCCAGGCCTGGAAGTGG + Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121014474 14:90539953-90539975 CTGTGGCCCATGAGTGCAGGAGG + Exonic
1121233791 14:92377725-92377747 CAGTGGGCTAGGCTGTCAGGAGG + Intronic
1121256574 14:92534703-92534725 CTGAGGGGCAGCCAGGCAGGGGG + Intronic
1122289419 14:100672186-100672208 CTGTGGCACAAGAGGGCAGGAGG - Intergenic
1122294787 14:100699313-100699335 CAGTGAGCCAGGCTTGCAGGAGG - Intergenic
1122307786 14:100776666-100776688 GTGTGGGCCGGGGGGGGAGGTGG - Intergenic
1122602294 14:102927924-102927946 CTGGCGGCCAGGGGTGCAGGAGG - Intronic
1122918236 14:104868570-104868592 CTTGGGGCCAGGAGGGTAGGGGG + Intronic
1122922313 14:104885122-104885144 CTCTGGCCCAGCTGGGCAGGAGG + Intronic
1122925744 14:104898955-104898977 CTGTGAGCAAGGCGGGCGGTCGG - Intergenic
1122970546 14:105150440-105150462 CTGGGTGCCAGGTGGGCAGGCGG - Intronic
1123020225 14:105394476-105394498 TGGTGGGCCAGGCAGGCAGGTGG + Intronic
1123044653 14:105505382-105505404 CCGGGGGCCAGGTGGGCAGGCGG + Intergenic
1124003170 15:25776490-25776512 CAGTAGGCCTGGCGTGCAGGAGG + Intronic
1124345326 15:28918316-28918338 CTGTGTGCCAGTTGGCCAGGTGG - Intronic
1125769271 15:42154221-42154243 CTGGGGACAAGGCAGGCAGGAGG + Intronic
1126094835 15:45080803-45080825 CTGGAGGCCAGGCAGGGAGGAGG + Intergenic
1128119100 15:65133068-65133090 ATGTGGGCGAGGCGCGGAGGAGG - Exonic
1129359053 15:75012980-75013002 CTGAGGCCCAGTCGGGGAGGTGG - Intronic
1129525701 15:76212732-76212754 CTGTGGGCAAGGCTGGCAGAGGG - Intronic
1129609627 15:77042983-77043005 CTGTGGGTCAGGCTGGCAAAGGG - Exonic
1129673169 15:77618149-77618171 CTCAGGGCCAGGCTGGCGGGTGG + Intronic
1129707043 15:77800204-77800226 CTTGGGGCTAGGCTGGCAGGTGG + Intronic
1130153761 15:81332482-81332504 CCGTGGGCCAGCCCAGCAGGAGG - Exonic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130546310 15:84859369-84859391 CAGTGGGCGAGGTGGGCAGGAGG + Exonic
1130979867 15:88804847-88804869 CTGTGGGGCTGGCTGCCAGGAGG + Intronic
1130988439 15:88860162-88860184 CTGTGGGCCAGGTGCCCAGGAGG + Intronic
1131106459 15:89737963-89737985 CTGTGGTCCAGGTGAGCAGGTGG - Intronic
1131382382 15:91974595-91974617 CTGTGGGCAGGGCAGGGAGGCGG + Intronic
1131405784 15:92163359-92163381 CTGTGGCCCAGCCGCGCAAGTGG - Exonic
1132081992 15:98874097-98874119 ATGTGGACAGGGCGGGCAGGAGG + Intronic
1132202419 15:99964119-99964141 CTGGTGGCCAGGAGGGGAGGTGG - Intergenic
1132551761 16:556523-556545 CTGAGTGGCAGGCGGGCTGGCGG - Intergenic
1132558912 16:584663-584685 TGGTGGGCCAGGTGGGCAGCTGG - Intergenic
1132729996 16:1356484-1356506 CTGAGGGCCAGGCGGAGGGGAGG + Intronic
1132731295 16:1363582-1363604 CTGTGGCCATGGCGGGCACGGGG - Exonic
1133218896 16:4309889-4309911 CTCTGGGCCCTGCGGGCAGGTGG + Intergenic
1133238557 16:4401463-4401485 CTGCGTGCCAGGCGGGCACCAGG + Intronic
1133252551 16:4493061-4493083 CTGTGGCCCAGGCTGGAAGCTGG + Intronic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1133784340 16:8963328-8963350 CTGCGAGCCCGGCGGGCGGGCGG + Exonic
1134024630 16:10944573-10944595 CTGTGGGCCGGGGAGGAAGGCGG + Exonic
1134070322 16:11256273-11256295 CTGGGGGCGGGGCCGGCAGGGGG - Intronic
1134203167 16:12215599-12215621 CAGTGGAACAGGCAGGCAGGTGG + Intronic
1134260582 16:12647967-12647989 CTGAGGGCCAGGAGGGCTGGAGG - Intergenic
1134467910 16:14495437-14495459 CTGTGGTCCAGGCTGGAATGTGG - Intronic
1134640306 16:15824689-15824711 CTGTGGTCCAGGAGGGAGGGAGG + Intronic
1134875395 16:17693705-17693727 CGGTGTGCCAGGAGGGAAGGGGG - Intergenic
1135675311 16:24409928-24409950 CTGTTGCCCAGGCTGGCATGCGG - Intergenic
1136010852 16:27362763-27362785 CTCTGGGTCGGGCTGGCAGGAGG - Exonic
1136186491 16:28591567-28591589 CTGTGGGGCAGGCAGACAGGAGG - Intronic
1136188976 16:28604291-28604313 CTGTGGGGCAGGCAGACAGGAGG - Intergenic
1136190017 16:28609951-28609973 CTGCGGGCGAGGAGGGCACGAGG - Exonic
1136497239 16:30651789-30651811 CGGCTGGCCAGGCGGGCTGGAGG - Exonic
1136737251 16:32475852-32475874 CTGGGGGCCAGCCGGGGAGCTGG + Intergenic
1137056998 16:35750731-35750753 GTGGGGGCCAGGGGGTCAGGAGG - Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137609373 16:49808813-49808835 CCCTGGGCCATGGGGGCAGGTGG - Intronic
1139430803 16:66910211-66910233 CTGTGGCCAAGGCAGGGAGGGGG - Intronic
1140892756 16:79298951-79298973 TGGTGGGCCAGGCGCTCAGGGGG - Intergenic
1141225458 16:82110787-82110809 GTGTGGGCCAGGTGGGTAGAGGG - Intergenic
1141836777 16:86545779-86545801 CTGTGTGCCAGGCAGGCACTGGG - Intronic
1142020415 16:87778896-87778918 CTGTGGTCCAGGTGCGCTGGGGG + Intergenic
1142108122 16:88317167-88317189 CTGAGGGCCAGGCCAGCATGTGG - Intergenic
1142140210 16:88469387-88469409 CTGAGGCCCAGGCCGGCAAGGGG - Intronic
1142225770 16:88876994-88877016 CAGTGGGCCAGGTGGGCTGGGGG + Exonic
1203015819 16_KI270728v1_random:353725-353747 CTGGGGGCCAGCCGGGGAGCTGG - Intergenic
1203034154 16_KI270728v1_random:626883-626905 CTGGGGGCCAGCCGGGGAGCTGG - Intergenic
1142868406 17:2805234-2805256 CTGGGGGCCAGCTGGGCATGAGG + Intronic
1142900678 17:3009601-3009623 CTGCGGTCCAGCCGGGCAGTGGG - Intronic
1142968158 17:3593703-3593725 GTGTGGGACAGGCGGTCAGTGGG - Intronic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1143593133 17:7897948-7897970 CTGTGGGGCAGGAGGCCATGGGG - Intronic
1144466702 17:15502934-15502956 CTTTGGGCCTGGAGGGGAGGTGG - Exonic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1145063995 17:19749685-19749707 CTGTGGGCCAGGCTGGCTGTGGG + Intergenic
1146208959 17:30927017-30927039 CTATGGGCCTGGTGCGCAGGTGG + Intronic
1146638286 17:34521937-34521959 TTGTGGGCCGGATGGGCAGGAGG + Intergenic
1147035212 17:37674901-37674923 CTCTGGGGCAGTCGAGCAGGAGG - Intergenic
1147304978 17:39556873-39556895 CTGAGAGCCAGGAGGGCAGCAGG - Intronic
1147422789 17:40331006-40331028 CTGGGGGCCAGGTGGGTTGGGGG - Exonic
1147512675 17:41084696-41084718 CTGTGGGCCAGTGGTGAAGGGGG - Exonic
1147514868 17:41106043-41106065 CTGTGGGCCAGTGGTGAAGGGGG - Exonic
1147582818 17:41636599-41636621 AGCTGGGCCAGCCGGGCAGGAGG + Intergenic
1147677925 17:42220110-42220132 CTGTGAGGCAGGCGGGCAGGAGG - Intronic
1147688123 17:42299462-42299484 CTGTGAGGCAGGCGGGCAGGAGG + Intronic
1147717415 17:42517683-42517705 CTGTGGCCCAGGACTGCAGGAGG + Intronic
1147955793 17:44133664-44133686 CTCTAGGCCAGGAAGGCAGGAGG - Intergenic
1148047050 17:44750692-44750714 CCTTGGGCAAGGCCGGCAGGAGG - Exonic
1148244702 17:46023003-46023025 CTGTGGGCAACACTGGCAGGTGG - Intronic
1149455095 17:56781393-56781415 CTGTGCGCCAGGCGCGAATGAGG - Intergenic
1149657503 17:58318110-58318132 CTGTGGGCGAGGCGCTCAGGTGG - Intronic
1150239794 17:63622473-63622495 CTGAGGGACTGGCGGGCGGGCGG + Exonic
1151678971 17:75614115-75614137 GGGTGGGCCAAGGGGGCAGGGGG - Intergenic
1151954333 17:77373110-77373132 GCGCGGGCCAGGCGGGGAGGAGG + Intronic
1152089300 17:78238060-78238082 ATGTTAGCCAGGGGGGCAGGTGG - Intronic
1152251827 17:79216431-79216453 CTGGGGGGCAGGCAGGAAGGAGG + Intronic
1152360774 17:79832190-79832212 CTGGGGGCCTGGCGGGCGCGGGG - Intergenic
1152363817 17:79844178-79844200 CTGCAGGCCAGCCGGGGAGGCGG - Intergenic
1152433282 17:80260952-80260974 CAGTGGGCCCCGCGGGCCGGCGG + Intronic
1152582286 17:81171377-81171399 TTGTGGCCCAGGCGGGCCAGGGG + Intergenic
1152784272 17:82239910-82239932 CTGCTGGCCACGAGGGCAGGTGG - Exonic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1153948558 18:10037956-10037978 CTGTGTGCCACGTGGTCAGGAGG - Intergenic
1154500170 18:14992097-14992119 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
1155336492 18:24770387-24770409 AAGGGGGCCAGGAGGGCAGGTGG - Intergenic
1156454717 18:37286549-37286571 CTGTGGGTCAGAGGGGCAGGGGG - Intronic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1157601163 18:48894013-48894035 CAGGGTGCCAGGCGGGCAGCCGG - Intergenic
1158456289 18:57611001-57611023 CTGTTGCCCAGGCTGGAAGGTGG + Intronic
1158567548 18:58568028-58568050 AGGTGGCCCAGGCTGGCAGGAGG - Intronic
1158749555 18:60243239-60243261 CTGGGGGCCAGACGGGAAGCAGG - Intergenic
1159080154 18:63727249-63727271 AGGTGGGCCAGGTAGGCAGGTGG - Intergenic
1159207004 18:65265730-65265752 CTGTTGCCCAGGCAGGAAGGTGG - Intergenic
1159708959 18:71729812-71729834 CTGTAGGCCAAGGGTGCAGGTGG + Intergenic
1159988028 18:74868643-74868665 CTGGGGCCCAGGCAGCCAGGTGG - Intronic
1160707160 19:535060-535082 CTGTGGCCCAGGAGGGCCGTGGG + Intronic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160725121 19:614448-614470 CTGTGTGCCAGCAGGGCAGGTGG + Intronic
1160834946 19:1120184-1120206 ATGGGGGGCGGGCGGGCAGGCGG + Intronic
1160930163 19:1566674-1566696 CTGCGGGGCGGGCGGGCGGGTGG - Intronic
1160984909 19:1834011-1834033 CTGGGCCCCAGGAGGGCAGGCGG + Intronic
1160986974 19:1843556-1843578 CTCCAGGCCAGGCAGGCAGGCGG + Intronic
1160999967 19:1905598-1905620 CGGTGGGCGACGCGGGGAGGCGG + Intronic
1161355852 19:3819288-3819310 GTGCTGGGCAGGCGGGCAGGTGG + Intronic
1161552707 19:4923092-4923114 CTGTGGTCTGGGCGGCCAGGAGG - Intronic
1161573898 19:5045129-5045151 CAGTGGGACAGGTGGGCGGGAGG - Intronic
1161592527 19:5135279-5135301 GTGTGGGGCAGGCGGGCGGGCGG - Intronic
1161605359 19:5211921-5211943 CTGTGGGCGGGGTGGGGAGGAGG - Intronic
1161620013 19:5292877-5292899 CTGGGGGCCAGGCGGGGGAGGGG + Intronic
1161854388 19:6754933-6754955 CTGGGGGCCCAGCAGGCAGGAGG + Exonic
1161979728 19:7624179-7624201 CTGGGGGCCAGCAGGGAAGGAGG - Intronic
1162360485 19:10217107-10217129 CTGTGGGCAAGGGGTACAGGTGG + Intronic
1162885265 19:13692373-13692395 CTGTGACTCAGGAGGGCAGGTGG + Intergenic
1163649578 19:18509472-18509494 CTGTGGGCCAAGGGGCCGGGTGG - Intronic
1165058810 19:33195003-33195025 CCCGGGGCCAGGCGGGCAAGCGG - Intronic
1165149303 19:33751597-33751619 CGGTGGGCCGGTCAGGCAGGAGG - Intronic
1166193742 19:41193354-41193376 GCGTGGGCCCGGGGGGCAGGTGG - Exonic
1166434833 19:42758581-42758603 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166444706 19:42848605-42848627 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166447688 19:42872349-42872371 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166448565 19:42879187-42879209 CTGTCGCCCAGGCTGGCATGCGG + Intronic
1166452142 19:42911162-42911184 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166454596 19:42930024-42930046 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166464395 19:43019352-43019374 AGGTGGGCCAGGCAGGCAGTTGG - Intronic
1166529693 19:43535006-43535028 CTGGGGGACAGGAGGGCTGGTGG - Intronic
1166858065 19:45792937-45792959 CTGTGGGCGGGGCGAGAAGGTGG + Intergenic
1166893806 19:46010557-46010579 CTGTGGGAGAGGGAGGCAGGAGG + Intronic
1166991233 19:46693971-46693993 GGGTGGGCCAAGTGGGCAGGGGG - Exonic
1167031967 19:46968363-46968385 CTGTGGGTCAGCAGAGCAGGAGG + Intronic
1167260711 19:48456198-48456220 CCGTGGGCTGGGGGGGCAGGTGG - Exonic
1167285626 19:48597372-48597394 CTGTCGCCCAGGCTGGCTGGAGG + Intronic
1167374442 19:49103509-49103531 CTGGGGGCCTGGCGAGGAGGCGG - Intronic
1167599109 19:50443688-50443710 CTGTGGGGCAGGGGGACAGGAGG - Intronic
1167608889 19:50496722-50496744 CCGTGGGCCAGGCCCGCAGGAGG + Intergenic
1167637214 19:50662048-50662070 CCTTGGTCAAGGCGGGCAGGTGG + Exonic
1167736663 19:51298579-51298601 CTGTAGGGCAGGCAGGCAGGAGG + Intergenic
1168295749 19:55376758-55376780 CCTGGGGCCTGGCGGGCAGGCGG + Intergenic
1168333356 19:55582418-55582440 CTGTTGCCCAGGCTGGCTGGAGG + Intergenic
1168340057 19:55617567-55617589 CTCAGGGCCTGGCAGGCAGGAGG - Exonic
925919686 2:8630537-8630559 CTGAGGGGCGGGGGGGCAGGGGG + Intergenic
926083494 2:10006897-10006919 CTGCGGGCCATGCAGGCTGGGGG + Intergenic
926202588 2:10812553-10812575 AAGTGGGCCTGGCGGGCGGGAGG - Intronic
927156647 2:20224769-20224791 CCGGCGGCCAGGCGGGGAGGCGG - Intronic
927215777 2:20667212-20667234 CCGTGGGCCGGGCGGGCGGGCGG - Exonic
927522401 2:23707243-23707265 CTGTGGGACAGCCGGGGAGCAGG + Exonic
927885875 2:26718181-26718203 CTGTGGGAGATGGGGGCAGGTGG - Intronic
929599832 2:43198158-43198180 CTGAAGGCCAGGCTGGCAGTGGG + Intergenic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
932751138 2:74372397-74372419 CTGTGGGGCAGGGGAGAAGGTGG + Intronic
932761258 2:74440497-74440519 CCGTGGGCCTGGCGTGGAGGCGG - Intronic
933978375 2:87529875-87529897 CTGAGGGCCATGCGGGCAGTGGG - Intergenic
934619196 2:95793793-95793815 CTGTGGGACATCCTGGCAGGGGG - Intergenic
934641695 2:96030764-96030786 CTGTGGGACATCCTGGCAGGGGG + Exonic
934661025 2:96143792-96143814 CAGTGGGGCAGGCAGGCAGAGGG + Exonic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
934985218 2:98880505-98880527 GTATGGGCACGGCGGGCAGGTGG + Intronic
935088094 2:99867920-99867942 CCCTGGGCGAGGCGGGCACGTGG + Intronic
935664277 2:105496683-105496705 CTTTGAGCCAGGTGGGCAGCTGG + Intergenic
936122677 2:109760380-109760402 CCGGGGGCCAGGCGGGGCGGGGG + Intergenic
936222016 2:110611093-110611115 CCGGGGGCCAGGCGGGGCGGGGG - Intergenic
936315457 2:111420926-111420948 CTGAGGGCCATGCGGGCAGTGGG + Intergenic
936370550 2:111898811-111898833 CTGGGGGCCAGGCGAGGGGGTGG + Intronic
937257241 2:120564275-120564297 CTGGGGGCGAGGCGGGCAGAGGG + Intergenic
937680583 2:124640357-124640379 GTGTGGCCCACGCAGGCAGGTGG + Intronic
937999343 2:127719847-127719869 CTGAGGGCCAGGCGGGCCTTGGG + Exonic
938461071 2:131497104-131497126 CTGTTGCCCAGGCTGGCATGCGG - Intergenic
938499383 2:131822456-131822478 CTGTGGGCTGGGAGGGCAGCTGG + Intergenic
939992595 2:148889391-148889413 CTGGGGGCCAGGCTGGTGGGAGG + Intronic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
942251087 2:174048442-174048464 CTGCGGGCCTGGCGGGGAGCCGG - Intergenic
942451225 2:176108830-176108852 CAGTGGCCCGGGCGGGCGGGCGG + Intronic
943701896 2:190996029-190996051 ATGTGGGGCAGAGGGGCAGGAGG + Intronic
946044523 2:216810355-216810377 CTGTGGGGGAGACGGGCGGGAGG + Intergenic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
948022079 2:234742312-234742334 CTGTGGTGCAGGGAGGCAGGAGG + Intergenic
948362496 2:237432899-237432921 CTGTGGCCGAGGTGGGCGGGCGG - Intergenic
948491290 2:238314931-238314953 CTGATGCCCAGGTGGGCAGGAGG + Intergenic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
948815427 2:240507850-240507872 CTGTGGGACAGGCCAGCAGCGGG - Intronic
949054751 2:241921768-241921790 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
949054845 2:241922089-241922111 CTCTGGGACAGGAGGCCAGGGGG + Intergenic
1169074278 20:2751828-2751850 CTGTGGGCAAGGGGGTGAGGAGG + Intronic
1169197860 20:3693023-3693045 CTGAGGGCCAGCTGGGCGGGCGG + Exonic
1171293470 20:23995769-23995791 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG + Intergenic
1171412510 20:24956699-24956721 CTGAGAGCCAGGCGGGCAAAAGG + Intronic
1172319389 20:33984513-33984535 CTGTGGGCCAGGTGTGATGGTGG - Intergenic
1172847505 20:37938603-37938625 CTGTGGGGCAAGCAGGGAGGAGG + Intronic
1172854795 20:37993572-37993594 CTGTGGGCCCCTCTGGCAGGTGG - Intronic
1172893359 20:38282789-38282811 CTGAGAGCTAGGAGGGCAGGAGG - Intronic
1174054486 20:47788509-47788531 CTGTGGGCCTGGCGGACACGTGG + Intergenic
1174658303 20:52190542-52190564 CTGGGGGACTGGCGGGGAGGGGG - Intronic
1174777712 20:53361055-53361077 CTGGGGGCTGGGCGGGCAGCGGG - Intronic
1175111188 20:56649260-56649282 CTGTCGCCCAGGCTGGCATGCGG + Intergenic
1175391648 20:58631413-58631435 CTGGGGTCCAGGGGGCCAGGAGG - Intergenic
1175447279 20:59032051-59032073 CTGTGGGCAAAGCGCTCAGGCGG - Intronic
1175518961 20:59587558-59587580 CTGTGGGTCAGGGGTGCAGGTGG + Intronic
1175793824 20:61758762-61758784 CTGCAGGGGAGGCGGGCAGGTGG - Intronic
1175802323 20:61807886-61807908 CTGTGGGCCTGGCGGGATGCAGG + Intronic
1175881754 20:62263293-62263315 CTGTGGGCTCTGCGGGCAGAGGG + Intronic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176388627 21:6152071-6152093 CTGTGCCCCTGGCAGGCAGGCGG + Intergenic
1176710409 21:10145680-10145702 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1177730671 21:25024326-25024348 CAGTGAGCCAGGCAGGCGGGTGG + Intergenic
1178383950 21:32134592-32134614 CTGGGGGCCATGGTGGCAGGTGG - Intergenic
1179198058 21:39183857-39183879 CTGCGGGCTAGAGGGGCAGGGGG + Intergenic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179715256 21:43283060-43283082 CTGTTGGCCACGTGGGCTGGGGG + Intergenic
1179734845 21:43386177-43386199 CTGTGCCCCTGGCAGGCAGGCGG - Intergenic
1179960512 21:44764869-44764891 ATGTGTGCCAGGAGGGAAGGGGG - Intergenic
1180535302 22:16390067-16390089 CTGGGGGCCAGCCGGGGAGCTGG - Intergenic
1180824526 22:18853485-18853507 CTTTGAGCCAGGTGGTCAGGAGG + Intronic
1180967936 22:19800261-19800283 ATCTGGGCCAGGACGGCAGGAGG + Intronic
1180982367 22:19884872-19884894 CTGTGTGCCAGGCAGCCACGAGG - Intronic
1181051884 22:20241822-20241844 GTCTGGGCCAGGCAGGCAGCGGG - Exonic
1181165222 22:20979604-20979626 CTGTGGGCCGGGCAGGTGGGTGG - Intronic
1181210987 22:21289430-21289452 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1181277232 22:21694696-21694718 CTGGGGGCCAGGCAGGCAGGGGG + Intronic
1181398513 22:22637458-22637480 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1181405774 22:22684198-22684220 ATGAGGGCCAGGCAGGCAGCAGG - Intergenic
1181408466 22:22701752-22701774 ATGAGGGCCAGGCAGGCAGCAGG - Intergenic
1181413787 22:22745251-22745273 ATGAGGGCCAGGCAGGCAGTAGG - Intronic
1181501250 22:23316816-23316838 CTTTGAGCCAGGTGGTCAGGAGG - Exonic
1181650902 22:24258602-24258624 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
1181672750 22:24433315-24433337 CTGGGAGCCAGGCGGGCGGCTGG + Exonic
1181706479 22:24652137-24652159 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1182686486 22:32124224-32124246 CTGGGGCCCAGGAAGGCAGGTGG + Intergenic
1183010545 22:34943162-34943184 CTTTGGGGGAGGCTGGCAGGTGG + Intergenic
1183216135 22:36481469-36481491 CTGGCGGCCGGGCGGGCGGGGGG - Intronic
1183328808 22:37208491-37208513 CTGTGAACCTGGGGGGCAGGTGG + Intronic
1183662720 22:39230867-39230889 CTGTGGGCGAGGCTGGCCTGGGG + Intronic
1183715666 22:39532261-39532283 CTGTGTGCCAGGCGCGGAGCGGG - Intronic
1184004830 22:41700122-41700144 CTGCGGGCCAGGGGCGCATGCGG + Intronic
1184093805 22:42305830-42305852 CTGAGGGCCAGGCCTGCATGAGG - Intronic
1184352814 22:43955632-43955654 CTCTGGGCCAGCAGGGCAGACGG + Intronic
1184376601 22:44117375-44117397 CTGTGGGCCATGGGGGGTGGGGG + Intronic
1184493862 22:44826033-44826055 CTGTGTACCCGGAGGGCAGGGGG - Intronic
1184595247 22:45509877-45509899 CTGTGGGGCAGGTGGGGTGGGGG + Intronic
1184688171 22:46105711-46105733 CTCTGGTCTGGGCGGGCAGGCGG - Exonic
1184710399 22:46246307-46246329 GGGTGGGCCAGGTGGGGAGGTGG - Intronic
1185105893 22:48869598-48869620 CTGGGGGCCAGGGTGGAAGGTGG - Intergenic
1185134288 22:49060316-49060338 CTCTGGGGCAGGAGGGCTGGAGG - Intergenic
1185172879 22:49303895-49303917 GCCTGGGCCTGGCGGGCAGGAGG - Intergenic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1185275281 22:49947959-49947981 ATGGGGGCCACGGGGGCAGGTGG + Intergenic
1185343943 22:50303317-50303339 CTTTGGACCAGCAGGGCAGGGGG + Intronic
1203215959 22_KI270731v1_random:6000-6022 CTTTGAGCCAGGTGGTCAGGAGG - Intergenic
1203274664 22_KI270734v1_random:79390-79412 CTTTGAGCCAGGTGGTCAGGAGG + Intergenic
949837154 3:8281427-8281449 CTGTGGGCCAGGCCTAGAGGTGG - Intergenic
950053740 3:10010047-10010069 GTGTGAGCCAGGCAGGCAGGGGG - Intronic
950585166 3:13887088-13887110 CTGTGCGCCAGGCTGGTAGGAGG + Intergenic
952416854 3:33097226-33097248 CTGTGGCCGAGCCGGGCGGGTGG + Exonic
952764233 3:36941348-36941370 CTGTGAGCCTGGTGGGCTGGTGG - Intronic
952887731 3:38021887-38021909 ATGTGGGACAGGCTGGCTGGGGG - Intronic
952901706 3:38115525-38115547 ATGTGGGCCAGGGGAGCATGTGG + Intronic
952925265 3:38315459-38315481 CTGCTGGCCAGCTGGGCAGGTGG + Intronic
953228393 3:41042081-41042103 CTGTGTGGCAGGCTGGCATGTGG - Intergenic
954275652 3:49540025-49540047 CCGTGGGGCCGGCGGGCGGGCGG + Intergenic
954300749 3:49699593-49699615 GTCTGGGCCAGGCGGGGTGGGGG + Intronic
954632879 3:52056517-52056539 CGGAGGGCCGGGCGGGCGGGCGG - Exonic
954685201 3:52366509-52366531 CTGTGGGCCCGACGAGCATGAGG - Exonic
955339260 3:58112333-58112355 CTGGGGGCCAGGGGAGCAGAGGG - Intronic
955651731 3:61202198-61202220 CAGTTGGCCAGCCGGGCAGAGGG - Intronic
956324389 3:68035202-68035224 CTGTGGGCCAGGCCAGCCTGTGG + Intronic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961277381 3:125738578-125738600 CTAAGAGCCAGGCGGGCAAGAGG - Intergenic
961277407 3:125738658-125738680 CTAAGAGCCAGGCGGGCAAGAGG - Intergenic
962369042 3:134805535-134805557 CTGCTGGGCAGGAGGGCAGGAGG - Intronic
963001743 3:140688058-140688080 CTGTGGGTCAGGCCTGTAGGTGG - Exonic
965429494 3:168568754-168568776 CAGGGGGCCAGGGGGCCAGGGGG - Intergenic
965429499 3:168568762-168568784 CAGGGGGCCAGGGGGCCAGGGGG - Intergenic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
966928567 3:184661172-184661194 CTGCATGCCAGGCAGGCAGGAGG + Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967192505 3:186997025-186997047 CTGTGTTGGAGGCGGGCAGGTGG + Intronic
967678052 3:192324053-192324075 CTGTCGCCCAGGCTGGCATGCGG - Intronic
967997894 3:195180361-195180383 TTGAGGGCCAGGCGGGCCAGGGG - Intronic
968073271 3:195801453-195801475 CAGTGAGCCATCCGGGCAGGAGG - Intronic
968173798 3:196531333-196531355 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
968205284 3:196794466-196794488 CTTGGCGCCAGGCGGACAGGGGG - Intronic
968222658 3:196949766-196949788 GTGTGTGGGAGGCGGGCAGGTGG + Intronic
968232999 3:197015322-197015344 GCGTGGGCCAGGTGGGCGGGTGG - Intronic
968533935 4:1112593-1112615 CTGGGGGAGAAGCGGGCAGGCGG - Intronic
968845099 4:3036629-3036651 CAGAGGGTCAGGCAGGCAGGAGG - Intronic
968869651 4:3235169-3235191 CTATGGGCCAGGCGGGCTCCCGG - Intronic
968876378 4:3269853-3269875 CTCTGCGCCAGGCGGCCGGGCGG - Intronic
968971829 4:3799739-3799761 CTGGGGGCCAGGTGTGCGGGTGG - Intergenic
969024964 4:4165838-4165860 CTAAGAGCCAGGCGGGCAAGAGG + Intergenic
969116133 4:4871830-4871852 CTGCGTTCCAGGAGGGCAGGCGG - Intergenic
969354855 4:6619455-6619477 CTGTGGAGCAGGAGGGCTGGGGG - Intronic
969444711 4:7237990-7238012 CTGTGGGCCAGGGGTGCTGTTGG + Intronic
969665982 4:8557897-8557919 CTGTGGGCCAGGGTGGGAGCTGG - Intergenic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
971054906 4:22901060-22901082 CTGTGAACCAGGCAGGCAGCAGG + Intergenic
972553089 4:40151308-40151330 CTGTTGCCCAGGCTGGCAGTTGG + Intronic
972605125 4:40606538-40606560 CTTGGGGCCAGGCGGGCCGTCGG - Intronic
972641175 4:40926480-40926502 CTGTTGCCCAGGCTGGCATGCGG + Intronic
973155289 4:46943971-46943993 GTGTGGGCCAGGGGGGAATGAGG + Intronic
973816390 4:54623263-54623285 CAGGGGGCCAGGAAGGCAGGAGG - Intergenic
974557716 4:63473004-63473026 CAGTGGGACAAGCTGGCAGGTGG + Intergenic
976530485 4:86146580-86146602 CTGTGGGCCAGGCCTGGAAGTGG - Intronic
978532571 4:109729935-109729957 CTGAGGGCCAGCCGGGAAGGAGG - Exonic
981654251 4:147093908-147093930 CTGTGGGCCAGCCTTGCAGAAGG + Intergenic
982437712 4:155397738-155397760 CTGTGGACCAGGCTGTAAGGAGG - Intergenic
983938934 4:173522234-173522256 CCCTGGGCCAGGCCGGCAGCTGG - Intergenic
984206627 4:176793293-176793315 CTGGGGGCCAGGCGTGCGGGAGG - Intergenic
984702074 4:182825064-182825086 CTGGGGGCCAGGGTGGCAGAGGG - Intergenic
985634983 5:1031452-1031474 CTCTCGGGCAGGCGGGCGGGAGG - Intronic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
987049170 5:14135279-14135301 CTGAGGGCAAGCCGGGAAGGGGG - Intergenic
988623955 5:32851269-32851291 CTGTGGGCCAGTGCGGCAGGAGG + Intergenic
990955044 5:61332395-61332417 CTGTCGGCCAGGCCCGCGGGCGG + Exonic
991925479 5:71701573-71701595 CTGGGTGGCAGGAGGGCAGGAGG + Intergenic
991938533 5:71827716-71827738 ATGTGTCCAAGGCGGGCAGGTGG + Intergenic
992390460 5:76326579-76326601 CTGCGGGCCAGGTGGGGTGGGGG - Exonic
996594404 5:125184823-125184845 CAGTGGACTAGGCGGGCACGCGG + Intergenic
998038400 5:138935626-138935648 CTGGGGGCGTGGCGGGGAGGAGG + Intergenic
999318851 5:150601089-150601111 GTGAGGAGCAGGCGGGCAGGCGG + Exonic
999369449 5:151045126-151045148 CTGTTGCCCAGGCTGGCACGCGG + Intronic
999733236 5:154492152-154492174 CTGGAGGCCAGGCAGCCAGGGGG + Intergenic
999767908 5:154755224-154755246 CTGGGCGACGGGCGGGCAGGAGG - Intronic
1000397194 5:160788268-160788290 CTGTTGGCCAAGTGGGGAGGAGG - Intronic
1000398984 5:160805619-160805641 CTGGGGCCCTGGCAGGCAGGCGG - Intronic
1001242225 5:170079558-170079580 CTGTGTGCCAGGAGTCCAGGTGG + Intronic
1001959884 5:175873181-175873203 ATTTGGGCCAGGCCGCCAGGAGG - Intronic
1002070932 5:176678621-176678643 ATGTGGGCCAGGCAGACATGTGG - Intergenic
1002587149 5:180256395-180256417 GGGTGGGGCAGGGGGGCAGGGGG + Intronic
1002632824 5:180591982-180592004 CTGTGGCCCGGCCGGGGAGGCGG - Intergenic
1002879417 6:1238154-1238176 CTGTGGGCCCAGGGGCCAGGTGG + Intergenic
1003094295 6:3130485-3130507 TGGTGGGCCAGGCTGGCAGGTGG - Intronic
1004510084 6:16278047-16278069 CCGTGGGACAGGCAGGCAGGAGG + Intronic
1004620509 6:17326703-17326725 CTGAGGGCCTGGAGGCCAGGAGG + Intergenic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1005296347 6:24431239-24431261 CTGTGGACCAGGGTGGAAGGTGG - Intronic
1005873623 6:29995246-29995268 CTAGGGACCAGGAGGGCAGGAGG + Intergenic
1006435106 6:34021970-34021992 AGGAGGGGCAGGCGGGCAGGCGG + Exonic
1006463425 6:34177205-34177227 CCGTGGGCCAGGGAGGGAGGAGG - Intergenic
1006922785 6:37637413-37637435 CTGTGGGCTGGACTGGCAGGGGG + Exonic
1007061399 6:38944131-38944153 CTCTGTGCCAGGCCTGCAGGTGG + Intronic
1007557922 6:42782481-42782503 CGGGGGCGCAGGCGGGCAGGGGG + Intronic
1007764459 6:44152570-44152592 CTGGGGGGGAGACGGGCAGGAGG - Intronic
1007774519 6:44217529-44217551 TGGCGGGCCAGGCGGGCAGCAGG - Intergenic
1008555652 6:52670976-52670998 CTGTAGGCCAGGCAGCCAGGAGG - Intergenic
1010659939 6:78557625-78557647 GTGTGGGGCAGGTGGGAAGGGGG - Intergenic
1011696340 6:89917280-89917302 CTGTGGGCTAGGCCAGTAGGTGG + Intergenic
1011786692 6:90854421-90854443 CTGTGGTCCAGGAGAGCAGGTGG + Intergenic
1014079447 6:117270520-117270542 CTGTAGGCCGGCCGGGGAGGCGG - Intronic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015786799 6:136927054-136927076 CTGTAGGCCATGCTGGCAGGTGG + Intergenic
1016523032 6:144967965-144967987 CTGTGGGCCAGGCCAGGAGGTGG - Intergenic
1017024816 6:150172460-150172482 CTGTGGTGCAGGTGGGGAGGCGG + Intronic
1018629204 6:165807532-165807554 CTGGGGGCCAGGATGGCATGGGG + Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1018923898 6:168193762-168193784 ATATGGGCCTGGTGGGCAGGAGG + Intergenic
1019140114 6:169937644-169937666 ATGTGGGGCCGGCGGGCAGGTGG - Intergenic
1019191692 6:170254871-170254893 CTGTGGGCCTGGTGGGCACCAGG + Intergenic
1019258243 7:65210-65232 CTGTGGTCCAGCCGGGGAAGGGG + Intergenic
1019352661 7:562236-562258 CTGCCTGCCAGGCGGGGAGGTGG + Intronic
1019510288 7:1414292-1414314 TTGGGGGGCAGGCGGGGAGGAGG - Intergenic
1019558744 7:1645496-1645518 CTGTGGGCCCGGAGGCCAGCGGG - Intergenic
1019649350 7:2148374-2148396 CTGTGGGGCTGGTGGGCAGTGGG - Intronic
1020204723 7:6105379-6105401 CTGGGGGCCGGGCAGGCAGGCGG + Intronic
1021245398 7:18255663-18255685 CTGTTGCCCAGGCGGGCGCGCGG + Intronic
1021761294 7:23904979-23905001 CGGTGGGGCCGGCGGGCCGGCGG + Intergenic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1022293209 7:29023116-29023138 CAGTAGGCCAGGCTGGCAAGTGG - Intronic
1022299588 7:29090540-29090562 CTGAGCACCAGGAGGGCAGGGGG + Intronic
1023126741 7:36961798-36961820 CTGTGGGACAGAGGGGCAAGAGG - Intronic
1024216801 7:47255159-47255181 CTGTGGCCCAGGCAGGGATGTGG - Intergenic
1024224057 7:47312212-47312234 CTGTGGGCCATACTGGGAGGAGG - Intronic
1024512225 7:50213082-50213104 AGATGGGGCAGGCGGGCAGGTGG + Intergenic
1024971969 7:55079047-55079069 CCGTGGGCCGGGCAGGCAGCAGG + Intronic
1025704041 7:63846220-63846242 CTGTGGCCCAGGCTGGAATGCGG + Intergenic
1026805055 7:73424171-73424193 CTGTGGGCCGGACAGGCCGGCGG + Intergenic
1026866629 7:73828080-73828102 CCGGGGGCCGGGGGGGCAGGAGG + Intronic
1026896142 7:74011062-74011084 CTGAGGGCCAGAGGGGCAGTGGG - Intergenic
1027232614 7:76281568-76281590 CGGCGGGCGGGGCGGGCAGGCGG + Exonic
1027374627 7:77537485-77537507 CTCTGTGCCGGGCGGGCGGGCGG + Exonic
1027682242 7:81235299-81235321 TTGTAGTCCTGGCGGGCAGGTGG - Intergenic
1028057332 7:86262538-86262560 CTGGGGGCTAGGTGGGCAGTGGG - Intergenic
1029222921 7:99004418-99004440 GAGTGGGCCAGCCTGGCAGGTGG + Intronic
1029269832 7:99370491-99370513 CTGTGGGACGGGTGGGCAGGTGG + Intronic
1029503629 7:100949318-100949340 ATGTGGGCCAGGCAGGCTGTGGG + Intergenic
1029561229 7:101303864-101303886 CTGGGGACTAGGCGGCCAGGTGG - Intergenic
1030673431 7:112362117-112362139 GTGGTGGCCAGGTGGGCAGGGGG - Intergenic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1030820706 7:114087548-114087570 CAGTGGCCCCGGCGGGCAGGCGG + Intronic
1032020712 7:128405972-128405994 CCGCGGGCCGGGCGGGCCGGGGG + Intronic
1032085862 7:128883717-128883739 GTGAGGCCCAGGCAGGCAGGGGG - Intronic
1033529181 7:142245773-142245795 CCCTGGGGCAGGTGGGCAGGAGG + Intergenic
1034276619 7:149826607-149826629 CTGTGGGGGAAGCCGGCAGGTGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034313603 7:150110811-150110833 CTGAGGGCAAGGCTGGCAGGGGG + Intergenic
1034496934 7:151428645-151428667 CGGGGGGCCAGCAGGGCAGGGGG + Intergenic
1034508926 7:151519226-151519248 CCGCGGGCCGGGCGGGCAGGTGG - Intronic
1034793293 7:153989985-153990007 CTGAGGGCAAGGCTGGCAGGGGG - Intronic
1034969385 7:155409584-155409606 CTGGGGGCCAGGCTAGGAGGGGG - Intergenic
1035021665 7:155804230-155804252 CAGGCGGGCAGGCGGGCAGGCGG - Intronic
1035165277 7:156985717-156985739 CTGTGGGCCAGGCATGGAGGCGG - Intergenic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1035546556 8:486277-486299 CCCTGGCCCAGGAGGGCAGGTGG + Intergenic
1035586601 8:780156-780178 GTGAGGGCCAGGCTGGTAGGTGG - Intergenic
1035695287 8:1591321-1591343 ATGTGGGCCAGGTGGGAAGGAGG + Intronic
1036262707 8:7253223-7253245 CTGAGAGCCAGGGGGGCAAGAGG + Intergenic
1036303878 8:7586335-7586357 CTGAGAGCCAGGGGGGCAAGAGG - Intergenic
1036314747 8:7711762-7711784 CTGAGAGCCAGGGGGGCAAGAGG + Intergenic
1036904128 8:12693470-12693492 CTAAGAGCCAGGCGGGCAAGAGG + Intergenic
1036936142 8:13004286-13004308 CCGTGGACCAGGTGGGGAGGAGG + Intronic
1038261860 8:26002851-26002873 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261863 8:26002859-26002881 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261866 8:26002867-26002889 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261876 8:26002895-26002917 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261879 8:26002903-26002925 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1039961903 8:42254832-42254854 CTGTGGGGCGGCCGGGCAGAGGG - Intergenic
1039984471 8:42436206-42436228 CAGTGAGGCAGGCAGGCAGGAGG - Intronic
1042625969 8:70757621-70757643 CTGTCGCCCAGGCTGGCATGTGG + Intronic
1043214981 8:77574355-77574377 CTGTGGGCCTGGGGTGGAGGTGG + Intergenic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1045063535 8:98427197-98427219 GTGTGCGCCCGGCGGGCCGGCGG - Exonic
1045277495 8:100721351-100721373 CGGTCGGCCGGGCGGGCGGGCGG - Intronic
1047205891 8:122802781-122802803 ATGGGGGCAAGGCTGGCAGGGGG + Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048428384 8:134343655-134343677 CTGTGTGCCAGGCGTACGGGAGG - Intergenic
1048430566 8:134366839-134366861 CTGTGGACCAGGAGGTCATGTGG - Intergenic
1048886326 8:138912835-138912857 CTCTGGAACAGGCCGGCAGGCGG + Intronic
1048956761 8:139543769-139543791 CCCTGGGCCAGGTGGGAAGGAGG + Intergenic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049140428 8:140949612-140949634 GAGTGGGCCAGGGCGGCAGGGGG - Intronic
1049298540 8:141856598-141856620 CTGTGGGCTGGAAGGGCAGGAGG + Intergenic
1049300425 8:141866753-141866775 CTGTGGGGCAGGTGAGCAGCAGG + Intergenic
1049320851 8:141995446-141995468 CTCAGGGACAGGCTGGCAGGAGG - Intergenic
1049796515 8:144499616-144499638 CTGCGGGGCAGGCGGGGATGTGG + Intronic
1051019548 9:12525729-12525751 CTGGTGACCAGGAGGGCAGGTGG - Intergenic
1053647389 9:40131378-40131400 CTGTGGGCTAGGGGGGCAGCTGG - Intergenic
1053758338 9:41332465-41332487 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1054328377 9:63729332-63729354 CTGTGGGCTAGAGGGGCAGCTGG - Intergenic
1054537190 9:66244792-66244814 CTGTGGGCTAGGGGGGCAGCTGG + Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057083570 9:92189700-92189722 CACTGGGCCACGGGGGCAGGGGG - Intergenic
1060115421 9:120936474-120936496 CTTTGGGCAAGGCTGGCAGGGGG - Intergenic
1060150920 9:121287515-121287537 CTGTGGACCAGGTGTGCAGCAGG - Intronic
1060265882 9:122111232-122111254 CGGTGGGCCAGGGTGCCAGGTGG - Intergenic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1060968565 9:127724936-127724958 CCGAGGGCAGGGCGGGCAGGAGG + Intronic
1061001356 9:127904710-127904732 CTGTGAGAGTGGCGGGCAGGTGG + Intronic
1061131945 9:128713314-128713336 TTGTGGGGCAGACGGGCTGGGGG + Exonic
1061202107 9:129143855-129143877 CTGTGGGACAGGCGGGGGTGGGG - Intronic
1061248644 9:129414118-129414140 CTGTAGGCCAGGAGAGGAGGGGG + Intergenic
1061295339 9:129673963-129673985 ACGTGGGGCAGGGGGGCAGGTGG + Intronic
1061539748 9:131271715-131271737 CTGTGGGCCAGGTTCCCAGGGGG + Intronic
1061542462 9:131284976-131284998 CTGTGGGACACGTGGCCAGGAGG + Intergenic
1061588706 9:131584433-131584455 CCGTGAGGCAGGAGGGCAGGCGG + Intronic
1061725815 9:132581380-132581402 CTGTGGGCCTGGCGGGAGTGGGG - Intergenic
1061828234 9:133274991-133275013 CTGGGGAGCCGGCGGGCAGGTGG - Intronic
1061919366 9:133774312-133774334 CTGTGTGCCTGGCCTGCAGGAGG - Intronic
1062035533 9:134380977-134380999 ATGTGGCCCCAGCGGGCAGGAGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062533916 9:137013377-137013399 TGGTGGGCCAGGCGGGCGAGGGG - Intronic
1062540034 9:137037507-137037529 GGGTGGGCCAGGCAGGCTGGGGG - Exonic
1202795173 9_KI270719v1_random:114675-114697 CTGTGGGCTGGGGGGGCAGCTGG - Intergenic
1185610519 X:1391677-1391699 CACTGGGCCCGGCGGGCGGGGGG - Intronic
1186207219 X:7213456-7213478 CGGTGGGAAAGGCAGGCAGGAGG + Intergenic
1187680570 X:21763554-21763576 CTGTGGGCCAGGTGGGGGTGAGG - Intergenic
1190100336 X:47518058-47518080 CCCCGGGCCAGGCAGGCAGGTGG - Intergenic
1192224528 X:69219231-69219253 CTGTGGGAAAGGAGGCCAGGAGG - Intergenic
1192329141 X:70160099-70160121 CTTTGGCCCAGGGGGGCAGCTGG - Intronic
1192452833 X:71254171-71254193 CTCTGCACCAGGCGGGCGGGCGG + Intronic
1196494301 X:116306705-116306727 CTGTGGGCCGGTCGGGGAGTTGG - Intergenic
1197920376 X:131586497-131586519 CTGTGGCCCAGGCTGGAAGGGGG + Intergenic
1199516479 X:148682384-148682406 CTGTGGCCCATGGTGGCAGGAGG - Intronic
1199864111 X:151827636-151827658 CTGTGGGCCTGGAAGGAAGGAGG - Intergenic
1200079105 X:153566765-153566787 CAGTGGCACAGGCGGGCAGAGGG - Intronic
1200149679 X:153944957-153944979 CTGTGGGGCAGGGGTGCAGCAGG + Intergenic
1200658920 Y:5938344-5938366 CAGTGGGGCAGCCGGGCAGAGGG - Intergenic
1201504417 Y:14681881-14681903 CAATGGGCCAGGCGGGTGGGGGG - Intronic
1202272657 Y:23085949-23085971 CAGTGGGCCAGCCGTGCTGGGGG + Intergenic
1202293369 Y:23334733-23334755 CAGTGGGCCAGCCGTGCTGGGGG - Intergenic
1202425654 Y:24719693-24719715 CAGTGGGCCAGCCGTGCTGGGGG + Intergenic
1202445135 Y:24950392-24950414 CAGTGGGCCAGCCGTGCTGGGGG - Intergenic