ID: 1060934448

View in Genome Browser
Species Human (GRCh38)
Location 9:127507149-127507171
Sequence GACGCAGGTGGTGGTGACTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060934437_1060934448 19 Left 1060934437 9:127507107-127507129 CCTTGGGCCAGCAGGCCTCGGAT 0: 1
1: 0
2: 1
3: 20
4: 157
Right 1060934448 9:127507149-127507171 GACGCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 18
4: 180
1060934439_1060934448 4 Left 1060934439 9:127507122-127507144 CCTCGGATCTCAGTGACACCGTC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1060934448 9:127507149-127507171 GACGCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 18
4: 180
1060934438_1060934448 12 Left 1060934438 9:127507114-127507136 CCAGCAGGCCTCGGATCTCAGTG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1060934448 9:127507149-127507171 GACGCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 18
4: 180
1060934435_1060934448 26 Left 1060934435 9:127507100-127507122 CCGCAGACCTTGGGCCAGCAGGC 0: 1
1: 0
2: 1
3: 22
4: 267
Right 1060934448 9:127507149-127507171 GACGCAGGTGGTGGTGACTCAGG 0: 1
1: 0
2: 3
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060934448 Original CRISPR GACGCAGGTGGTGGTGACTC AGG Exonic