ID: 1060936930

View in Genome Browser
Species Human (GRCh38)
Location 9:127521492-127521514
Sequence CAGGATGTGAAGGGGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060936912_1060936930 23 Left 1060936912 9:127521446-127521468 CCAGTGCCCCAGCTGCCTCCTGC 0: 1
1: 1
2: 9
3: 83
4: 812
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936914_1060936930 16 Left 1060936914 9:127521453-127521475 CCCAGCTGCCTCCTGCCACCCCC 0: 1
1: 0
2: 12
3: 120
4: 1055
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936916_1060936930 8 Left 1060936916 9:127521461-127521483 CCTCCTGCCACCCCCAGCTGCTC 0: 1
1: 0
2: 13
3: 139
4: 1009
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936920_1060936930 -2 Left 1060936920 9:127521471-127521493 CCCCCAGCTGCTCCAGGAATGCA 0: 1
1: 0
2: 3
3: 36
4: 303
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936919_1060936930 1 Left 1060936919 9:127521468-127521490 CCACCCCCAGCTGCTCCAGGAAT 0: 1
1: 0
2: 3
3: 42
4: 438
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936921_1060936930 -3 Left 1060936921 9:127521472-127521494 CCCCAGCTGCTCCAGGAATGCAG 0: 1
1: 0
2: 2
3: 53
4: 414
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936922_1060936930 -4 Left 1060936922 9:127521473-127521495 CCCAGCTGCTCCAGGAATGCAGG 0: 1
1: 0
2: 1
3: 32
4: 314
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936924_1060936930 -5 Left 1060936924 9:127521474-127521496 CCAGCTGCTCCAGGAATGCAGGA 0: 1
1: 0
2: 3
3: 40
4: 432
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936915_1060936930 15 Left 1060936915 9:127521454-127521476 CCAGCTGCCTCCTGCCACCCCCA 0: 1
1: 2
2: 15
3: 156
4: 1187
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936913_1060936930 17 Left 1060936913 9:127521452-127521474 CCCCAGCTGCCTCCTGCCACCCC 0: 1
1: 0
2: 10
3: 167
4: 1032
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data
1060936917_1060936930 5 Left 1060936917 9:127521464-127521486 CCTGCCACCCCCAGCTGCTCCAG 0: 1
1: 2
2: 7
3: 103
4: 885
Right 1060936930 9:127521492-127521514 CAGGATGTGAAGGGGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060936930 Original CRISPR CAGGATGTGAAGGGGTCCCT GGG Intronic
No off target data available for this crispr