ID: 1060936988

View in Genome Browser
Species Human (GRCh38)
Location 9:127521712-127521734
Sequence CAGGAAGGTGTCCTGCCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060936988_1060936995 3 Left 1060936988 9:127521712-127521734 CCACCCGGCAGGACACCTTCCTG 0: 1
1: 0
2: 4
3: 14
4: 178
Right 1060936995 9:127521738-127521760 CAGGACACCCCTTCATTCCCTGG No data
1060936988_1060937002 21 Left 1060936988 9:127521712-127521734 CCACCCGGCAGGACACCTTCCTG 0: 1
1: 0
2: 4
3: 14
4: 178
Right 1060937002 9:127521756-127521778 CCTGGCCCAGCAGCTCTCCTGGG No data
1060936988_1060937000 20 Left 1060936988 9:127521712-127521734 CCACCCGGCAGGACACCTTCCTG 0: 1
1: 0
2: 4
3: 14
4: 178
Right 1060937000 9:127521755-127521777 CCCTGGCCCAGCAGCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060936988 Original CRISPR CAGGAAGGTGTCCTGCCGGG TGG (reversed) Intronic
900350813 1:2233666-2233688 CAGGCAGGTGCCCAGCCAGGTGG + Intronic
901037769 1:6346699-6346721 CAGCAGGGTGACCTGCCAGGAGG + Intronic
901496573 1:9625875-9625897 CAGGAGGGCGACCTGCTGGGAGG + Intergenic
901738001 1:11324479-11324501 CAGGAAGGCTTCCTGGGGGGTGG + Intergenic
901807408 1:11747380-11747402 GAGGGAGGTGACCTGCGGGGTGG + Intronic
902516383 1:16991917-16991939 AAGGAAGATGCCCTGCCTGGTGG - Intronic
902827641 1:18987935-18987957 CAGGAAGGAGTCCTGGGAGGTGG + Intergenic
905208195 1:36355018-36355040 CAGGAAGGTGGCCTGCAGGGTGG + Intronic
905389691 1:37628518-37628540 CAGGAAGATCTCCTGCCTGTGGG + Intronic
907321694 1:53606655-53606677 CAGGAAGGTGGACAGCCCGGTGG + Intronic
914988480 1:152479064-152479086 CAGGAGGGTGTCCTAACAGGAGG + Intergenic
916468102 1:165092567-165092589 CAGAAAGCTGTCCTGCTGTGGGG + Intergenic
922046613 1:221951421-221951443 TAGGATAGTGTCCTGCTGGGAGG - Intergenic
922785183 1:228279102-228279124 CAGGAAGGAACCCTGCCGGAGGG + Intronic
923022650 1:230176873-230176895 CAGGAAGGTGTTCTGCTGGGTGG + Intronic
1063362687 10:5470514-5470536 GAGGAGGGTGTCCTGGCAGGTGG - Intergenic
1067090160 10:43262387-43262409 CAGGAAGGAATCCTGGGGGGTGG - Intronic
1074532941 10:114309501-114309523 CAGGTAGGTGTCCTGAAGCGTGG - Intronic
1077153638 11:1082097-1082119 CAGGAAGGTGGCCTGGAGGCTGG + Intergenic
1078557598 11:12342903-12342925 CAGGAAGGAATCTTACCGGGAGG + Intronic
1078920572 11:15826624-15826646 CAGGGAGGTGACCTGGCTGGAGG - Intergenic
1079289716 11:19176705-19176727 CAGGAAGGTGCCATGCCCAGGGG - Intergenic
1081761187 11:45577386-45577408 CAGGGAGGTGGTCTGCCAGGGGG + Intergenic
1084284629 11:68122969-68122991 CTGGAAGTTGACCTGCAGGGAGG + Intergenic
1084485656 11:69446666-69446688 AAGGGAGGAGGCCTGCCGGGGGG - Intergenic
1085510626 11:77086429-77086451 CAGGAAGGTGGGGTGCAGGGAGG - Intronic
1087784740 11:102342005-102342027 CTGGAAGGTGTCCAGCTGTGAGG - Intergenic
1089443799 11:118535564-118535586 CAGGAAGGTGCCCTTCCTGGAGG + Exonic
1091692906 12:2609264-2609286 CAGGAAGCTGTCGTGGTGGGAGG + Intronic
1092124587 12:6066203-6066225 CTGGAAGGTGTCCTGGCAGGGGG + Intronic
1094188868 12:27676477-27676499 CATGGAGGTGTCCTGCCCTGGGG - Exonic
1101858761 12:108465465-108465487 CAGTAAGGATTGCTGCCGGGAGG + Intergenic
1102177512 12:110886832-110886854 CAGGAAGACCTCCTTCCGGGAGG - Intronic
1103452460 12:121038915-121038937 CACGAAGGAGTCCAGCCTGGAGG + Exonic
1103557794 12:121776408-121776430 CAGGAAGGTGGGCTGCAGGATGG - Exonic
1103950856 12:124550257-124550279 CTTGAATGTGTCCTGCAGGGAGG - Intronic
1104773310 12:131378362-131378384 CCGCAAGCTGTCCTGCCGGCTGG + Intergenic
1106331527 13:28743837-28743859 CAGGAAGGCCTCCTGCAGGTGGG + Intergenic
1106482723 13:30148903-30148925 CAGGAAGCTCTCCTGGCGTGAGG + Intergenic
1106498837 13:30307686-30307708 CACGAAGGTGCCCTGCCACGGGG - Intergenic
1107631120 13:42343753-42343775 CAGGTAGGTGTCCTGTCCAGAGG - Intergenic
1112806120 13:103165636-103165658 ATGGAAGGTGTCCTGCAGAGTGG - Intergenic
1113458609 13:110466329-110466351 CAGGCACGTGTGCTGCCAGGAGG + Intronic
1114206641 14:20578436-20578458 CTGGAAAGTCTCCTGCTGGGAGG - Intergenic
1115548964 14:34488135-34488157 CAGGAAGGTGTCCAGCCTGGGGG - Intergenic
1117224139 14:53637637-53637659 CAGGGAGGTGCCCTGCAGAGGGG - Intergenic
1120885452 14:89448443-89448465 CAGGATGGTGTGGTGCAGGGAGG - Intronic
1121082573 14:91120207-91120229 CAGGAAGGACACCTGCCCGGAGG - Intronic
1121917467 14:97848870-97848892 CTGGAAGGAGACCTGCAGGGAGG - Intergenic
1122112267 14:99510689-99510711 CAGGAGGCTGTCCTCCAGGGGGG - Exonic
1122411491 14:101528270-101528292 CAGGGTGGGGTCCTGCCAGGTGG + Intergenic
1122979297 14:105184498-105184520 AAGGAAGCTGTCCTGGCAGGAGG + Intergenic
1124137510 15:27048115-27048137 CAGCAAGGGGTGCTGCAGGGGGG + Intronic
1125513954 15:40307727-40307749 CAGGAAGGAGGCCAGCCAGGAGG + Exonic
1128155574 15:65389624-65389646 CAGGAAGGTTTCCTGGAGGAAGG - Intronic
1129447540 15:75629400-75629422 CAGGAAGGTGTCCAGCCCAGAGG + Intergenic
1132866031 16:2093193-2093215 CAGGAAGGTGAGCTGGCAGGGGG + Intronic
1132885754 16:2181280-2181302 CAGGCTGGAGTCCTGCCGCGTGG + Exonic
1133170372 16:3979256-3979278 CAGGATGGTGTTCTTCCTGGAGG - Exonic
1135867210 16:26114625-26114647 CAGGGAGGTGTCCTGTCAGTTGG + Intronic
1136466156 16:30445414-30445436 CAGGAAGCCGGCCTGCCGGCAGG - Exonic
1136530131 16:30862544-30862566 CAGGAGCGTGTCCTGTTGGGAGG - Intronic
1136615242 16:31394415-31394437 CAGGGAGGTGTCCTGGAGGAAGG + Intronic
1137614743 16:49839461-49839483 CAGGCAGGAGTTCTGCCGGGTGG + Intronic
1137647491 16:50088683-50088705 CAGCAAGATGTCCTGTGGGGTGG + Intronic
1142355711 16:89600826-89600848 CAGTCAGGGGTCCTGCCGGCCGG + Intergenic
1142982638 17:3680614-3680636 CAGGGTGGTGGCCTGCAGGGTGG - Intronic
1142982652 17:3680657-3680679 CAGGGTGGTGGCCTGCAGGGTGG - Intronic
1143997227 17:11017339-11017361 CAGAAGGGTTTCCTGCCTGGTGG - Intergenic
1144207183 17:12987564-12987586 TAGGAAGGCGTCCTGAGGGGAGG + Intronic
1145817219 17:27804286-27804308 CAGGAATGCGGCCTGCTGGGTGG - Exonic
1146055331 17:29578000-29578022 CAGGAAGGAGTGATGCAGGGGGG + Intronic
1146689143 17:34861131-34861153 CAGTAAGGTGTCTTTCCTGGTGG - Intergenic
1148559574 17:48598085-48598107 CAGGAAGGACTCCTGCCCGCTGG + Exonic
1148754752 17:49967263-49967285 CAGTCAGGTGTCCTGCAAGGAGG - Intergenic
1155294718 18:24374564-24374586 CAGTAAGGTGTCCTGAGGGAAGG + Intronic
1155393917 18:25366612-25366634 CATGGAGGTGTCCTCCCTGGTGG + Intergenic
1157425441 18:47580563-47580585 CAGGAAGGGGGCCTCCCTGGGGG + Intergenic
1159480857 18:68989609-68989631 CAGGCAGGGGGCCTGCGGGGAGG + Intronic
1160915878 19:1496274-1496296 CAGGAAGGCGCACTGCAGGGCGG - Exonic
1161729439 19:5950243-5950265 CGGGAAGGAGTCCAGCCAGGAGG - Intronic
1161755028 19:6126583-6126605 CTGGAAGGAGTCCTGCTGGAAGG - Intronic
1162327102 19:10005971-10005993 CAGGAAAGTGGCCTTCTGGGTGG + Exonic
1164780029 19:30884630-30884652 CAGCATGGTGTCCTGCCGCAGGG - Intergenic
1165914282 19:39248214-39248236 CAGAAGGGAGCCCTGCCGGGAGG - Intergenic
1166445752 19:42856293-42856315 GAGGAAAGTGTCCTACCTGGAGG + Intronic
1167381515 19:49140989-49141011 CAGGAAGGTGCCCTGCTTTGAGG - Intronic
1167909656 19:52691091-52691113 AAGGAAGGTGGCCTTGCGGGAGG - Intergenic
1168357578 19:55712054-55712076 CAGCAGAGCGTCCTGCCGGGAGG - Intronic
926217486 2:10914304-10914326 GAGGTAGGTGTGCAGCCGGGTGG + Intergenic
926397022 2:12453932-12453954 CGGGGAGGTGTCCCGGCGGGGGG + Intergenic
927157821 2:20231742-20231764 CAGGAAGCTCTCCAGCAGGGAGG + Intergenic
927211469 2:20641538-20641560 CAGGAAGATGACCTGCCAGCCGG - Intronic
927468794 2:23356939-23356961 CAGGCAGGAGTCCTGCGGGGAGG + Intergenic
932318461 2:70802134-70802156 CAGGAAGGAGTCCTGTGGAGAGG - Intergenic
934308242 2:91843077-91843099 TGGAAAGATGTCCTGCCGGGTGG + Intergenic
935692771 2:105745330-105745352 CAGGAAGGTGCAGAGCCGGGAGG - Intronic
945729939 2:213521167-213521189 CAGGAAGGTGGCCTGGTTGGTGG + Intronic
947369288 2:229428119-229428141 CAGGCAGGTGTCAGGCCTGGTGG + Intronic
948095716 2:235332599-235332621 CAGGAAGGTGGCCTCAGGGGAGG - Intergenic
948100150 2:235366703-235366725 CAGGAAGCTGTCCTTCCTCGGGG - Intergenic
1168849998 20:969927-969949 CAAGAATGTTTCCTGCCGGGTGG - Intronic
1168896325 20:1326070-1326092 CAGGAAGGTCTCCTGGAGGAAGG + Intronic
1170893568 20:20395529-20395551 CAGCAAGGTGCCCTGCTGGGAGG + Intronic
1173165632 20:40685235-40685257 CAGAGAGGTGTCCTGCCTGGAGG + Intergenic
1174355923 20:49997927-49997949 CAGGAAGGTGGCCTGGAGGAGGG + Intergenic
1175242978 20:57563289-57563311 CAGAGAGGTGTGCTGACGGGTGG - Intronic
1175862017 20:62155637-62155659 CAGGAAAGTGACCAGCCTGGAGG - Intronic
1176425802 21:6547579-6547601 CAGGGAGGTGGGCTGCTGGGGGG - Intergenic
1179437727 21:41373839-41373861 CAGGCAGGTGTCCTCCCAGCCGG + Intronic
1179701293 21:43155896-43155918 CAGGGAGGTGGGCTGCTGGGGGG - Intergenic
1182818796 22:33194702-33194724 CAAGAATGTGGCCTGCAGGGTGG - Intronic
1183190377 22:36318599-36318621 GAGGAAGGCGTCCTGGCTGGAGG + Intronic
1184721794 22:46318913-46318935 GAAGAAGGCTTCCTGCCGGGAGG - Intronic
1184866870 22:47206242-47206264 CAGGAAAGTGCCCTCCAGGGCGG + Intergenic
1185197651 22:49482328-49482350 CAGGCGGGGGTCCTGCCGGCAGG - Intronic
950503453 3:13378435-13378457 CGGGAAGGTGTCCTGGCAGAGGG - Intronic
954100750 3:48370782-48370804 CAGGAAGGTGTGTTGGGGGGTGG - Intergenic
954314957 3:49795942-49795964 CAGGAAGGAGACCTGGCTGGAGG + Exonic
955046453 3:55364996-55365018 CAGGTAGGTGTTCTGCCAAGTGG - Intergenic
961223597 3:125219481-125219503 CAAGAGGGTGTCCTGCCAGAGGG + Intergenic
961674627 3:128557054-128557076 CTGGAATGTTTCCTGCCGCGGGG + Intergenic
962462439 3:135626997-135627019 CAGCAAGGTCACCTGCCTGGAGG + Intergenic
963575204 3:147052436-147052458 GAGGAACCTGTCCTGCTGGGAGG - Intergenic
964526994 3:157625569-157625591 CAGGTCGGTGTGCTGCAGGGTGG - Intronic
965961944 3:174440020-174440042 CTGAAGTGTGTCCTGCCGGGAGG - Intronic
967187072 3:186953386-186953408 AAGGAAGGTGTCCTGCCTGGAGG - Intronic
968003233 3:195221969-195221991 AACGAAGGGGTCCTGCCAGGCGG - Intronic
968262298 3:197335204-197335226 AAGGAAGGTGTCCTGGGGGCCGG - Intergenic
968514397 4:1010221-1010243 CAGGACGTTCTCCCGCCGGGAGG + Intronic
968573643 4:1355047-1355069 TGGGAAGCTGTCCTGCTGGGAGG - Intronic
968698722 4:2044778-2044800 GAGTCAGGTGTCCAGCCGGGAGG + Intergenic
979183094 4:117755135-117755157 CAGGATTGGGTCCTGCAGGGAGG + Intergenic
980027253 4:127781889-127781911 CAGGATGCTGTCCTGGCTGGCGG - Intronic
984709311 4:182871853-182871875 CAGGAAGGGGGCCTACCGCGTGG - Intergenic
984952742 4:185019129-185019151 CAGGTAGAAGTCCTGCCTGGAGG + Intronic
993311340 5:86337408-86337430 CAGGAATGAGTCCTGGCGTGTGG - Intergenic
994821138 5:104652561-104652583 AAGGATGGTGTCCTGCCCTGGGG + Intergenic
995570413 5:113474302-113474324 CAGGAAAGTGTCCAGAGGGGAGG + Intronic
997676848 5:135719620-135719642 CAGGAATGTGTCCTGGAGTGTGG + Intergenic
999177423 5:149641079-149641101 CAGGAAAGAGTCCTGCCGATGGG + Intergenic
1002065981 5:176651869-176651891 CAGGAAGGTGTTCTCCCGGAGGG - Exonic
1004187182 6:13430841-13430863 CAGGTAGGTATCCTGATGGGAGG - Intronic
1007249905 6:40488465-40488487 CAGGAAGGCTTCCTGCAGGAGGG - Intronic
1013106238 6:107028548-107028570 CAGGAAGGTGCACTGCCCGCGGG + Exonic
1014760912 6:125355871-125355893 CAGAAAAGTGTCCTGCAGAGGGG - Intergenic
1015354117 6:132256876-132256898 CAGGAAGGGGTCCTTCAGGGTGG - Intergenic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1017792431 6:157813230-157813252 CAGGACGGGGTCCTGTAGGGAGG - Intronic
1018848075 6:167568913-167568935 CAGCAAGCTCTCCTGACGGGAGG - Intergenic
1018864471 6:167736074-167736096 CTGGAAGCTGCCCTGCCGGCCGG + Intergenic
1018984223 6:168623702-168623724 CAGGAAGGTGAGATGCTGGGCGG + Intronic
1019544063 7:1564841-1564863 GAGGAAGGGGACCTGTCGGGGGG - Intergenic
1019544077 7:1564883-1564905 GAGGAAGGGGACCTGTCGGGGGG - Intergenic
1019713033 7:2526004-2526026 CAGGGAAGAGTCCTGCCGGATGG - Intronic
1019973077 7:4557860-4557882 CAGGAAGCTGCCCTGGCGGTTGG + Intergenic
1019996755 7:4729544-4729566 CAGGTGTGTGTCCTGCCGGGTGG - Intronic
1023022460 7:36022258-36022280 CAGGAAGATGTGCAGCCAGGAGG - Intergenic
1023360944 7:39414574-39414596 CAGGAAGCTTTGCTGCGGGGCGG + Intronic
1023839467 7:44088272-44088294 CCGGAAGGTGTCCCGCCACGAGG - Intergenic
1024220819 7:47285074-47285096 CTGGAAGGTGTGCTGGCAGGTGG + Intronic
1024261779 7:47578844-47578866 CAGGCCCGTGTCCTGCCGTGGGG - Intronic
1024308431 7:47947506-47947528 CAGCAAGGTGACCTGCCTGTGGG - Intronic
1029459003 7:100684853-100684875 CAAGGAGCTGTCCTGCAGGGAGG + Exonic
1030039324 7:105435513-105435535 TGGGAAGGTGTTCTGCCCGGAGG + Intergenic
1031353189 7:120760635-120760657 AAGGAAGGGGCCCTGACGGGAGG + Intergenic
1032193519 7:129777631-129777653 CAGGGCTGTGTCCTGCAGGGAGG - Intergenic
1032518958 7:132528226-132528248 CAGGAAGGTGAACTCCCAGGAGG + Intronic
1032536374 7:132668051-132668073 CAGGAAGGAGGCCTGCCCAGAGG - Intronic
1033159186 7:138981526-138981548 CAGGCAGGCGTCCGGCCGGCCGG - Intergenic
1035423898 7:158754096-158754118 CAGGCAGGTGCCCCGTCGGGAGG + Intronic
1035815160 8:2531111-2531133 CAGGTAAGTGTCCTGGAGGGAGG + Intergenic
1036398128 8:8386121-8386143 CAGGGAGGCGCCCGGCCGGGAGG - Intronic
1040899520 8:52403514-52403536 CAGGAAGGACTCCTTCCTGGGGG - Intronic
1043454169 8:80397185-80397207 CAGGAAGGTTTCCTGAAAGGTGG + Intergenic
1046830643 8:118742169-118742191 CAGGAAGGTGTACTGGCCTGAGG + Intergenic
1046838569 8:118830589-118830611 CAGGGAGGAGTCCTGCTGCGTGG - Intergenic
1049372713 8:142275367-142275389 CAGAAAGTTGTGCTGCCGTGCGG + Intronic
1051328948 9:16003480-16003502 CAGGAAGTTGTCCTCCCAGTGGG - Intronic
1053171810 9:35892412-35892434 CAGACAGGTTTCCTGCTGGGAGG + Intergenic
1057068344 9:92075108-92075130 CAGGATAGTGTCTTGCTGGGAGG - Intronic
1058254508 9:102744128-102744150 GAGGAAGGTGTCCAGCAGGGGGG - Intergenic
1060787227 9:126460256-126460278 CAGGAATGTGTCCAGCAAGGCGG - Intronic
1060936988 9:127521712-127521734 CAGGAAGGTGTCCTGCCGGGTGG - Intronic
1061676010 9:132216048-132216070 CAGGAAGGTGACCAGCCTTGGGG - Intronic
1061848801 9:133402822-133402844 CAGGAAGGCTTCCTGGAGGGAGG + Intronic
1203793196 EBV:162420-162442 CAGGGAGATGTCCTGCAGGATGG + Intergenic
1185479590 X:435896-435918 CAGGATGGTGTGAGGCCGGGAGG + Intergenic
1185767896 X:2740866-2740888 CAGGCAGGTGTCCTTCAGGGAGG - Exonic
1189643000 X:43094401-43094423 CATGAAGTTGTCCTGGGGGGTGG + Intergenic
1191067582 X:56366957-56366979 CAGGTTGGCGTCCTGCCAGGAGG + Intergenic
1191215590 X:57929487-57929509 CTGGAAGGTCTCCTGCTGTGAGG + Intergenic
1192152280 X:68719702-68719724 CAGGAAGGAGTCATGGTGGGAGG - Intronic
1194466172 X:94237483-94237505 CTGGTGGGTCTCCTGCCGGGAGG + Intergenic
1198084301 X:133268130-133268152 CAGGACAGTGTGCTGGCGGGGGG - Intergenic
1199983295 X:152932965-152932987 GAGGAAGGTGAGCTGCCCGGGGG + Exonic
1201719656 Y:17082635-17082657 CAGGAAGGTGTCCTGCACAGGGG - Intergenic