ID: 1060936991

View in Genome Browser
Species Human (GRCh38)
Location 9:127521716-127521738
Sequence GTGCCAGGAAGGTGTCCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 248}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060936991_1060937002 17 Left 1060936991 9:127521716-127521738 CCGGCAGGACACCTTCCTGGCAC 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1060937002 9:127521756-127521778 CCTGGCCCAGCAGCTCTCCTGGG No data
1060936991_1060937005 28 Left 1060936991 9:127521716-127521738 CCGGCAGGACACCTTCCTGGCAC 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1060937005 9:127521767-127521789 AGCTCTCCTGGGCCTCCCTCTGG No data
1060936991_1060936995 -1 Left 1060936991 9:127521716-127521738 CCGGCAGGACACCTTCCTGGCAC 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1060936995 9:127521738-127521760 CAGGACACCCCTTCATTCCCTGG No data
1060936991_1060937000 16 Left 1060936991 9:127521716-127521738 CCGGCAGGACACCTTCCTGGCAC 0: 1
1: 0
2: 0
3: 20
4: 248
Right 1060937000 9:127521755-127521777 CCCTGGCCCAGCAGCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060936991 Original CRISPR GTGCCAGGAAGGTGTCCTGC CGG (reversed) Intronic
900415511 1:2532734-2532756 GGGCCAGGATGGCGGCCTGCCGG + Intergenic
900596887 1:3484018-3484040 GTGAGAGGAAGGTGTGCGGCAGG - Intergenic
902247266 1:15129147-15129169 GTGGCAGGCAGGTGGCCTCCTGG + Intergenic
902614765 1:17617867-17617889 GTGCCAGGACGGCCTCGTGCTGG + Intronic
904275952 1:29384504-29384526 GAGCCAAGGAGGTGTCCTGGAGG + Intergenic
904326439 1:29729661-29729683 CTGCCTGGAAGGTGACCTGGGGG + Intergenic
904682516 1:32239502-32239524 GTGCCAAGAAGAGGTCCTGAGGG - Intergenic
905208192 1:36355014-36355036 TCACCAGGAAGGTGGCCTGCAGG + Intronic
905354777 1:37373835-37373857 GTGACAGGAAGCTTTCCTCCTGG + Intergenic
906236225 1:44212844-44212866 GTGCCACGAAGCTGGCCTCCAGG + Intergenic
906745985 1:48222549-48222571 GAGGAAGGAAGGAGTCCTGCAGG + Intergenic
908806839 1:67940355-67940377 TTGCAAGGACTGTGTCCTGCTGG - Intergenic
911154914 1:94627869-94627891 GTGCGGGGCATGTGTCCTGCGGG - Intergenic
913318583 1:117573552-117573574 ATGAAAGGAAGCTGTCCTGCTGG - Intergenic
915978217 1:160404356-160404378 GTGCCAGGGAAGGTTCCTGCAGG + Intronic
918404319 1:184196343-184196365 GTTCCAGGAAGGCTTCCTGGAGG + Intergenic
919604544 1:199665494-199665516 GTGACAAGAAGGTGACCTGTGGG + Intergenic
919724950 1:200875625-200875647 GTGCCTGAAATGTGTCCTGCTGG - Intergenic
919925285 1:202188869-202188891 TGGCCAGGAAGGTGCCCAGCTGG - Intergenic
920033289 1:203049792-203049814 ATGCCAGGACGGGGTCCTGATGG + Intronic
923022647 1:230176869-230176891 AGGCCAGGAAGGTGTTCTGCTGG + Intronic
924662280 1:246032203-246032225 TTGACAGGAAGATGTCCTGTGGG - Intronic
1063220451 10:3962110-3962132 CTTCCAGGAAGGTGAGCTGCTGG - Intergenic
1067297466 10:44982902-44982924 TTGCCAGCAAGGTGGCTTGCAGG - Intronic
1068043892 10:51861820-51861842 CTGCCATGAAGGTTTCCGGCTGG - Intronic
1070287215 10:75092821-75092843 GACCCAAGAAGGTGACCTGCTGG + Intergenic
1071895403 10:90060962-90060984 TTGCCAGGAAGGTGTGATGAAGG - Intergenic
1074388228 10:113034525-113034547 GTGCCAGAAAGTTGTACTTCTGG - Intronic
1075207154 10:120457493-120457515 GTGCCCGCAACGTGTCCTACGGG + Intronic
1075213077 10:120508356-120508378 TTGACAGAAAGGTGTGCTGCAGG - Intronic
1075517400 10:123119642-123119664 GTGCCAGGAAGCTGGCATGAAGG + Intergenic
1075798716 10:125139045-125139067 GTGCCAGGAATGTGCCAAGCAGG - Intronic
1075916916 10:126175679-126175701 GTGCCACGTAAGTGTCGTGCTGG + Intronic
1076450627 10:130554737-130554759 GGGCCATGGAGGTGTCCTGTGGG + Intergenic
1076571523 10:131436261-131436283 CAGCCCCGAAGGTGTCCTGCTGG - Intergenic
1076765833 10:132632535-132632557 CCGCCAGGAAGGGGTCCAGCAGG + Intronic
1076798712 10:132811008-132811030 GTGCCAGGTGGCAGTCCTGCTGG - Exonic
1076995613 11:296216-296238 GTGCCGGGCAGGAGTCTTGCAGG + Intergenic
1076997672 11:306847-306869 GGGGCAGGAACGTGGCCTGCAGG - Intergenic
1077153637 11:1082093-1082115 GGGGCAGGAAGGTGGCCTGGAGG + Intergenic
1077330089 11:1980388-1980410 GTGCCACGAGGGTGTCCACCTGG + Intronic
1078930130 11:15906222-15906244 GTGTCAGCAAGGTGTCTTGGAGG - Intergenic
1081127860 11:39342094-39342116 GGGCCAGGATGGTGTTCTGTTGG + Intergenic
1082772278 11:57217282-57217304 CTGGCAGGAAGCTGTCCTGGTGG - Intergenic
1084212919 11:67632105-67632127 GTGCCAGGCAGGCTTCCTGCAGG - Intronic
1084325138 11:68395924-68395946 GTGCCAGGAGGGTTTGCTCCTGG - Intronic
1084676717 11:70639742-70639764 GGGACATGAAGGTGCCCTGCAGG + Intronic
1084686327 11:70697995-70698017 GGGCAGGGGAGGTGTCCTGCTGG - Intronic
1084751657 11:71208188-71208210 GTGGCAGGAGGGTGCCCTGGAGG + Intronic
1085315803 11:75544242-75544264 GTGCCAGGCAGCTCTCATGCTGG + Intergenic
1085388150 11:76168924-76168946 GTGCCTGGAAGGACTCTTGCTGG + Intergenic
1085510629 11:77086433-77086455 GTGCCAGGAAGGTGGGGTGCAGG - Intronic
1088220197 11:107562663-107562685 GTGCTAGGAAGCTGGACTGCTGG - Intronic
1088741271 11:112769411-112769433 GTGGAAGGAAGGTGTGCAGCTGG + Intergenic
1090228050 11:125083381-125083403 GAGCCAGGAAGGAGACTTGCAGG - Intronic
1090657944 11:128860088-128860110 GGGCCAGACAGGTGTCCTTCCGG - Intronic
1090853877 11:130594867-130594889 GTACCATCAAGCTGTCCTGCTGG - Intergenic
1091356362 11:134940948-134940970 GGGCCATGAAGGTGTCAGGCAGG - Intergenic
1202813066 11_KI270721v1_random:35567-35589 GTGCCACGAGGGTGTCCACCTGG + Intergenic
1091797171 12:3304090-3304112 GTAGCAGATAGGTGTCCTGCGGG - Intergenic
1091814985 12:3430971-3430993 GTGCCAGGCAGGTGTGCTGGAGG + Intronic
1091856756 12:3746681-3746703 GTGCCAGCAAAGGGTCCTGCAGG - Intronic
1092104788 12:5913643-5913665 CTGCCACTAAGGGGTCCTGCTGG - Intronic
1097231607 12:57515313-57515335 GTGCCAATCTGGTGTCCTGCTGG - Exonic
1098671323 12:73234645-73234667 GTGCTAGGAACGTGGGCTGCAGG + Intergenic
1099650752 12:85424913-85424935 GTGCCCGAACGGTGTCCTACTGG + Intergenic
1099842651 12:87985564-87985586 GTGACATGAAGCTGTCCTGGAGG + Intronic
1100771549 12:97928356-97928378 GTGAGAGGAAGGAGTCCTGCAGG + Intergenic
1102925280 12:116821483-116821505 GTCCTGGGAAGGTGGCCTGCGGG - Intronic
1103242899 12:119429673-119429695 GTTCCATGAAGTTGTGCTGCTGG - Intronic
1103551962 12:121744438-121744460 GTTATAGGAAGGTGCCCTGCCGG + Intronic
1104968370 12:132520089-132520111 GTGCAAGGAGGGTGTGCTGGAGG - Intronic
1104968384 12:132520137-132520159 GTGCAAGGAGGGTGTGCTGGAGG - Intronic
1104968397 12:132520183-132520205 GTGCAAGGAGGGTGTGCTGGAGG - Intronic
1104968404 12:132520207-132520229 GTGCAAGGAGGGTGTGCTGGAGG - Intronic
1105727729 13:23182437-23182459 GAGACAGGAAGGTGTCATGAAGG - Intronic
1108164490 13:47677918-47677940 GTCCCAGCAAGGTGACCTTCGGG - Intergenic
1108251596 13:48573219-48573241 GTCCAAGGAAGGTGTTTTGCTGG + Intergenic
1114670922 14:24410483-24410505 GAGCCAGCAAGGGGTCCAGCTGG + Intronic
1118178043 14:63462537-63462559 GTGCAAGGCAGGTGTAGTGCTGG - Intronic
1118714283 14:68548233-68548255 GTCCCAGGCAGGGGTCCTGATGG - Intronic
1118761690 14:68884188-68884210 GCACAATGAAGGTGTCCTGCAGG + Exonic
1118761850 14:68885001-68885023 GTGCCTGGAAGGTCTCTTGAAGG - Intronic
1121342199 14:93112094-93112116 TTGCAAGGAATGTGTCCTGGGGG + Intronic
1121406342 14:93721397-93721419 GTGCCACCAAGGTGTCCCTCTGG + Exonic
1121528865 14:94638710-94638732 GTTCCTGGAAGGTTTCCTGGAGG - Intergenic
1122177866 14:99934472-99934494 CTGCCAGGCAGGAATCCTGCAGG - Intronic
1122804539 14:104249921-104249943 GTGCCAGGGAGGTGCCAGGCAGG - Intergenic
1122815383 14:104309612-104309634 GGGCCGGGAAGGCTTCCTGCTGG - Intergenic
1122987124 14:105217597-105217619 GTGCCAGGAAGCTGTCACGAAGG - Exonic
1124373483 15:29116296-29116318 GGGCCAGGAAAGTGTGCTGGGGG - Intronic
1125521049 15:40347983-40348005 GTGCGAGGGAAGTGTCCCGCAGG + Intergenic
1125606950 15:40944833-40944855 GTCCCAGGCAGCTGTTCTGCAGG - Intergenic
1126436791 15:48645399-48645421 GGGCCAGGAAGCTGTCAGGCAGG + Intronic
1127688756 15:61374220-61374242 TTGCAAGGAAGGTGTCATCCTGG + Intergenic
1128515537 15:68339629-68339651 ATGCCAGGATGGGGTTCTGCTGG - Exonic
1130127567 15:81106591-81106613 GTGACAGCAAGGTGTTCTCCAGG - Intronic
1131999596 15:98165277-98165299 GTCTCTGGAAGGTCTCCTGCTGG + Intergenic
1132716298 16:1291796-1291818 GTCACAGGAGCGTGTCCTGCTGG - Intergenic
1132746660 16:1439033-1439055 GGGCCAGGAAGCTCTTCTGCAGG + Exonic
1133328151 16:4954866-4954888 GTTCCTGGAAGGCATCCTGCTGG - Intronic
1136381657 16:29898892-29898914 GCCCCAGGAAGGCGTCCAGCGGG - Intronic
1136466159 16:30445418-30445440 GTCCCAGGAAGCCGGCCTGCCGG - Exonic
1137572765 16:49577668-49577690 CTGCCAACAAGGTTTCCTGCAGG - Intronic
1140412515 16:74749401-74749423 ATACCAGGACGGTGGCCTGCAGG - Intronic
1141336336 16:83158713-83158735 TGGCCAGGAAGGTGCCCAGCTGG + Intronic
1144194424 17:12876504-12876526 GTGCCTAGCAGGTGTTCTGCTGG - Intronic
1145994045 17:29095549-29095571 GTGTCCGGGTGGTGTCCTGCCGG - Intronic
1147994209 17:44352433-44352455 GGGCCAGGAAGGTGGCAGGCTGG - Exonic
1148339498 17:46864873-46864895 GCTCCTGGAAGGTGTCCTGGAGG - Intronic
1148674963 17:49439760-49439782 GTCCCAGGAAGGCTTCCTGGAGG - Intronic
1149439424 17:56662453-56662475 GTGCCTGGAAGGAGTGCTGTTGG - Intergenic
1149696611 17:58621320-58621342 AAGCCAGCCAGGTGTCCTGCTGG + Intronic
1150299873 17:64038881-64038903 ATTCCAGGAAGGTGGCCAGCTGG - Intergenic
1151554971 17:74842197-74842219 CTGCCAGGAGGGTGTGCTGTGGG - Exonic
1151569595 17:74919644-74919666 AGGCCAGGAAGGTCTCCAGCGGG + Exonic
1152911860 17:83009791-83009813 GTGCCAGAAACGTGTCTTTCTGG - Intronic
1153267514 18:3285662-3285684 GGGCCAGGAAGGTGGCATCCAGG - Intergenic
1154498283 18:14978352-14978374 GGGCCATGAAGGTGTCAGGCAGG + Intergenic
1155052702 18:22162751-22162773 TTCCCAGGAAGGGGTGCTGCTGG + Intergenic
1155352231 18:24917896-24917918 GTGGGAGGAAGATGTCCTGGGGG + Intergenic
1157535937 18:48457373-48457395 GTGACAGGGAGCTGCCCTGCTGG - Intergenic
1157555943 18:48612915-48612937 GTGTCAGAAGGGTGTGCTGCTGG + Intronic
1159184083 18:64947379-64947401 GCTTCAGGAAGGTGTCCTTCAGG + Intergenic
1159841889 18:73407678-73407700 CTGCCAGGAAGCGTTCCTGCAGG + Intergenic
1160051734 18:75440043-75440065 CTTCCAGGAAAGTGTTCTGCTGG + Intergenic
1160922278 19:1526620-1526642 GTGCCAGGAAGGGGAACTGTGGG + Intronic
1161267930 19:3373597-3373619 GGTCCAGGAAGGTCTCTTGCAGG - Intronic
1161357819 19:3828841-3828863 GTGCCAAGCCGGTGGCCTGCAGG - Intronic
1161515827 19:4695711-4695733 GTGCCAGGAAGGAAGCCTGTGGG - Intronic
1162390835 19:10389126-10389148 GTGCCAGAAAGGGGACCTTCAGG - Intergenic
1162903467 19:13809138-13809160 GGGCCAGGCGCGTGTCCTGCAGG - Exonic
1163468450 19:17483358-17483380 GTGCCTGGAAGGTTTCCTGAGGG + Intronic
1163693970 19:18753412-18753434 GTGTCAGGGACGTGTCCTCCTGG + Intronic
1164776833 19:30859274-30859296 GTGCCTAGAAGCTGCCCTGCTGG + Intergenic
1165068025 19:33240335-33240357 GTGCCAGGGAGCTGGCCTGGAGG - Intergenic
1167234214 19:48303876-48303898 GGGGCACGAAGGTGTGCTGCAGG + Intronic
925103071 2:1265956-1265978 GTCCCAGGAAGGTGTCTGGTGGG + Intronic
925994552 2:9281420-9281442 GTGTCAGGAAGCTGGCCTGCAGG + Intronic
926581735 2:14637228-14637250 ATGTCAAGAAGGAGTCCTGCAGG - Exonic
927468792 2:23356935-23356957 ATGGCAGGCAGGAGTCCTGCGGG + Intergenic
927518007 2:23683137-23683159 GGGCCAGGAAGGAGTCCTGGCGG + Intronic
928300300 2:30118485-30118507 GTGAAAGGAAGGAGTCTTGCGGG - Intergenic
931828436 2:66025924-66025946 ATGCCAGGGAGGTGGCCTCCAGG + Intergenic
934563070 2:95323213-95323235 GTGCCAGGAAGGTGGCCATGGGG - Intronic
935675646 2:105592980-105593002 GTGCCAGGAAGGAGACGTGGAGG - Intergenic
935783852 2:106531542-106531564 GGGCCAGGATGATGTCCTGCAGG + Intergenic
936066461 2:109336190-109336212 GTGCCTAGAAGCTGGCCTGCAGG + Intronic
936254541 2:110900645-110900667 GTCCCAGGATGGTCTCCTACAGG + Intronic
936397608 2:112141165-112141187 GTGACTGGAAGATGCCCTGCAGG - Intronic
936954755 2:118013368-118013390 GCACCAGGGAGGTGTCCCGCTGG - Intronic
937436497 2:121885941-121885963 GTGCCAGGCCAGTGACCTGCAGG + Intergenic
938196608 2:129334331-129334353 GCGCCAGGGAGGCCTCCTGCCGG + Intergenic
943830380 2:192453060-192453082 GTGCCAGCAAGGTGTTGTGGAGG - Intergenic
945019107 2:205553324-205553346 GTGCCTGGAAGGGGTCCAGATGG + Exonic
946175406 2:217919393-217919415 GTGCCCGCAAGGTGTCCTTCCGG + Intronic
946456193 2:219828404-219828426 GTGCTAGGCAGGTGTGCTGTGGG - Intergenic
947281467 2:228460340-228460362 GTGCCAGCAAAGTGTCATGGGGG + Intergenic
948115850 2:235494053-235494075 GTGCCAGGGAGGGGGCCGGCCGG + Intergenic
948425201 2:237882973-237882995 GAGCCAGGCAGGTGACCTGATGG + Intronic
948809538 2:240467571-240467593 GTGTTGGGAAGGGGTCCTGCAGG + Exonic
1168850001 20:969931-969953 GAGCCAAGAATGTTTCCTGCCGG - Intronic
1169787244 20:9372147-9372169 GTGCCTGGAAGTTGGCCTCCTGG + Intronic
1171971952 20:31570165-31570187 GTGCCCGGTCGGTCTCCTGCTGG - Exonic
1172272985 20:33664764-33664786 GTGGCAGGAAGGCGGGCTGCAGG - Intronic
1172789518 20:37493156-37493178 GTGGCTGGGAGGTGTCCTCCAGG + Intronic
1174355921 20:49997923-49997945 GGGTCAGGAAGGTGGCCTGGAGG + Intergenic
1174485000 20:50855537-50855559 GTCCCAGGAAGGTCTCTTGGAGG - Intronic
1175048789 20:56133288-56133310 GTGCCAGGAAGGAGGCTTACAGG + Intergenic
1175824174 20:61927710-61927732 GAGCCAGGGAGGGGTTCTGCGGG - Intronic
1175954159 20:62599749-62599771 GTGCCCTGAAGGTGTCCTGGTGG - Intergenic
1176145383 20:63563130-63563152 GTACCAGGAAGCCGTGCTGCAGG + Exonic
1179606389 21:42518313-42518335 GTGGAAAGAAGGTGTCCTGCTGG - Exonic
1179990612 21:44946633-44946655 GTTCCAGGAGGCTGTCCTGTGGG + Intronic
1182464473 22:30505816-30505838 GGGACAGGGAGGTGACCTGCCGG + Intergenic
1183439054 22:37812989-37813011 GTGTGTGGAAGCTGTCCTGCGGG + Intronic
1183953998 22:41368481-41368503 GTGGAAGGAAGGAGTCCTGCGGG - Intronic
1184348558 22:43927926-43927948 GTCCAAGGAACCTGTCCTGCAGG + Intronic
1184866868 22:47206238-47206260 GTGGCAGGAAAGTGCCCTCCAGG + Intergenic
949244284 3:1907259-1907281 CTGCCAGGTAGGGTTCCTGCTGG - Intergenic
950147717 3:10663780-10663802 ATGCCAGGAAGGTGTCTGGGAGG - Intronic
950433770 3:12966903-12966925 CTGCCAGGAAGGCCTCTTGCAGG - Intronic
950579677 3:13854038-13854060 GCCCCAGGATGGTGTCCTGGGGG - Intronic
950905698 3:16536041-16536063 GTGCCAGGAAAGCCCCCTGCTGG + Intergenic
954278754 3:49560638-49560660 GTGCCAGGAGCATGTCATGCTGG + Intronic
954756478 3:52843167-52843189 GTGCAAGGAACGTGCCCTGACGG + Intronic
957985886 3:87572810-87572832 GGAGCAGGAGGGTGTCCTGCTGG - Intergenic
960995238 3:123336190-123336212 GGGCCAGGATGGGGTTCTGCAGG - Intronic
961104596 3:124230350-124230372 GATCCAGGAAGGTCTCCTGGAGG - Intronic
961660909 3:128468371-128468393 GTACCAGGAAGGTCTCCCCCGGG + Intergenic
961786085 3:129347736-129347758 GGGCAAGGCAGGTGTCCTGGGGG + Intergenic
962456320 3:135568546-135568568 AAGCCATGAAGGTGTGCTGCTGG - Intergenic
962710265 3:138080389-138080411 GTGCCAGGCATGTGACATGCAGG - Intronic
965245669 3:166263857-166263879 GTGCCATGCTGGTGTGCTGCAGG - Intergenic
966803464 3:183786355-183786377 ATACAAGGAAGGTGTCCAGCAGG + Intronic
967243058 3:187460003-187460025 GAGCCAGGAAAGTGCTCTGCAGG + Intergenic
968555661 4:1245368-1245390 GAGCCAGGAAGGTGGCGTTCTGG - Intronic
968902142 4:3436813-3436835 TTCCCAGGAGGGGGTCCTGCTGG - Intronic
969060088 4:4427267-4427289 GTGCCAGGAAAGCTCCCTGCAGG + Intronic
972311486 4:37887805-37887827 GGCCCAGGAAGGTGTTCTGTTGG - Intergenic
977605865 4:98984568-98984590 GGGTCAGGAGGGTGTCCTCCAGG - Intergenic
980009303 4:127578721-127578743 CTGCCTGGAGGGAGTCCTGCTGG + Intergenic
981455428 4:144947997-144948019 GTGGCAGGAGGGTGACTTGCAGG - Intergenic
982724026 4:158886466-158886488 GTGGCAGGAAGGTGCCGGGCTGG + Intronic
985671712 5:1210184-1210206 GTGCCAGGAAGGTGTGAGCCGGG + Intronic
985671721 5:1210229-1210251 GTGCCAGGAAGGTGTGAGCCTGG + Intronic
985707561 5:1410287-1410309 GTGCCTGGACGGTGTCCCACAGG - Intronic
985878562 5:2619643-2619665 CTGCTAGAAATGTGTCCTGCTGG - Intergenic
989417371 5:41195441-41195463 GTGCCAGGGTGGGGTCCTGGAGG - Intronic
989988176 5:50727781-50727803 GTACCAGGAAAGTTTCCTGCAGG - Intronic
991934325 5:71786897-71786919 GTGACAGGAAGGGGACCTGCAGG - Intergenic
992518315 5:77520932-77520954 CTGCCAGTAAGATGTCCTGGAGG - Intronic
992953420 5:81883419-81883441 GAGCTAGGAAGGTGGACTGCAGG + Intergenic
1001945071 5:175771965-175771987 GTGCCAGGAGGGTGGCATGGTGG - Intergenic
1002462316 5:179380546-179380568 GTTCCTCGAAGGTTTCCTGCTGG - Intergenic
1003390420 6:5708463-5708485 GCCCCAGGCAGGTGTCCTGAAGG + Intronic
1005726465 6:28654097-28654119 TTGCCATGAATGTGTCTTGCAGG - Intergenic
1006399961 6:33811843-33811865 GTGACAGGAAGATTACCTGCAGG + Intergenic
1006882795 6:37354336-37354358 GAGGGAGGAAGGTGTCTTGCTGG + Intronic
1006982911 6:38159948-38159970 GTGATAGGAACGTGTCCTACGGG + Intergenic
1007249908 6:40488469-40488491 GGTCCAGGAAGGCTTCCTGCAGG - Intronic
1007483801 6:42166941-42166963 GTCCCAGGAGGGATTCCTGCAGG + Intronic
1008899443 6:56594928-56594950 CTCCCAGGCAGGTGTGCTGCAGG + Intronic
1009428790 6:63543345-63543367 GTGCCAAGAAGGAAACCTGCAGG - Intronic
1010875559 6:81100924-81100946 GTGCCTGGAAGATTTCTTGCAGG + Intergenic
1013162195 6:107555564-107555586 GCGCTTGGAAGGTGCCCTGCTGG - Intronic
1018573443 6:165233930-165233952 GAGGCAGGAAGGTGTCCCACCGG - Intergenic
1018910189 6:168097306-168097328 GTGCAGGGAAGGTGGCCTGGCGG - Intergenic
1019617620 7:1973356-1973378 GTACCAGGATGGTGTCCGCCAGG - Intronic
1019935943 7:4258041-4258063 GTGCCAAGAAGGGGGCCTGGCGG - Intronic
1020989353 7:15178052-15178074 GAACCAGGAAGGAGTTCTGCAGG - Intergenic
1022706886 7:32810262-32810284 GTGCCAGGCAGGGGCGCTGCTGG - Intergenic
1023052409 7:36264558-36264580 ATGCCATGACAGTGTCCTGCAGG - Intronic
1024925118 7:54604510-54604532 GAGCCAGGAAGGTGGCCCTCCGG + Intergenic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1034266399 7:149783139-149783161 GTGTCAGGAAGTCGTCCTGCTGG - Intergenic
1035708822 8:1697100-1697122 GAGCCAGGAGAGTCTCCTGCGGG - Intronic
1035901879 8:3465518-3465540 GTGCCAGGAAAGCATCCTCCAGG + Intronic
1035962079 8:4148434-4148456 GTGCCATGTTGGTGTGCTGCAGG - Intronic
1036397437 8:8381296-8381318 CTGACAGGAAGCTATCCTGCAGG + Intronic
1036716934 8:11134154-11134176 GGGCAAGGAAGGTGTCATGAAGG - Intronic
1039057873 8:33551015-33551037 GTGCCAGGAAAGTGTGCAGGAGG - Intronic
1041870435 8:62627964-62627986 GTGCCAGGAAGAAGGCCTGTTGG - Intronic
1043177383 8:77039491-77039513 GTTCCATGAATGTGCCCTGCTGG + Intergenic
1043547843 8:81335321-81335343 TTTCCAGGAAGGAGTCCTGACGG + Intergenic
1047035340 8:120932201-120932223 GTACTAGGAAGGCCTCCTGCAGG - Intergenic
1047534456 8:125706636-125706658 ATGCAATAAAGGTGTCCTGCTGG + Intergenic
1048964267 8:139604039-139604061 GAGCCAGGAAGTTCTCCTTCAGG + Intronic
1049216422 8:141410352-141410374 GAGCCAGGCAGGTGGCCAGCAGG - Intronic
1050394877 9:5185498-5185520 GTGCCAGGAAGCTGTGCGGCAGG - Exonic
1050588221 9:7135343-7135365 GTGCCAGGAACCTGTCCTTTGGG - Intergenic
1051432533 9:16994670-16994692 GTGCCAAGAAGGTGGGATGCTGG + Intergenic
1053410181 9:37911230-37911252 GTGCCAGAAAGGCTTCCTGTGGG - Intronic
1056829188 9:89900684-89900706 CTGCCAGGAAGGTTTCCCTCTGG - Intergenic
1056838388 9:89976883-89976905 GTGCCAGGACGATGTTCTCCAGG - Intergenic
1057075908 9:92138047-92138069 TGGCCAGGAAGGTGCCCAGCTGG - Intergenic
1059507958 9:114817089-114817111 CTGCCAGGCAGATGTCCTGAAGG - Intergenic
1060936991 9:127521716-127521738 GTGCCAGGAAGGTGTCCTGCCGG - Intronic
1061849077 9:133403981-133404003 GTGCCAGGACAGAGCCCTGCTGG + Exonic
1062550150 9:137082415-137082437 GTGACAGGAGGGTCCCCTGCTGG + Intronic
1185498320 X:576475-576497 GTGCCAGGATGTTCACCTGCAGG - Intergenic
1187526532 X:20059922-20059944 GTGTCTGGAATGTGCCCTGCTGG - Intronic
1189172941 X:38926695-38926717 GTCCCAGGGAGGTGTGCTCCAGG + Intergenic
1189304880 X:39979489-39979511 TTGCTAGGAAGGTGACATGCGGG - Intergenic
1189361743 X:40358829-40358851 GGGGCAGGGAGGTGTCCTACAGG + Intergenic
1189803707 X:44715181-44715203 GTGGCAGGCAGGTGTTGTGCTGG - Intergenic
1195788701 X:108557894-108557916 GTGCCATGAAGCTGTCCTTCGGG + Intronic
1195903616 X:109823219-109823241 GTGACAGGAAGTATTCCTGCAGG - Intergenic
1195948666 X:110243212-110243234 GTGGCTGGAAGGTTTCCTGGAGG - Intronic