ID: 1060937066

View in Genome Browser
Species Human (GRCh38)
Location 9:127522016-127522038
Sequence GGCTAACGGCTGACCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060937066_1060937077 11 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937077 9:127522050-127522072 GAGAGATGGCACCAGGCCAGGGG No data
1060937066_1060937084 24 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937084 9:127522063-127522085 AGGCCAGGGGCTGGGGAGGCGGG No data
1060937066_1060937075 9 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937075 9:127522048-127522070 TGGAGAGATGGCACCAGGCCAGG No data
1060937066_1060937087 28 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937087 9:127522067-127522089 CAGGGGCTGGGGAGGCGGGAGGG 0: 2
1: 2
2: 39
3: 318
4: 2061
1060937066_1060937086 27 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937086 9:127522066-127522088 CCAGGGGCTGGGGAGGCGGGAGG No data
1060937066_1060937081 20 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937081 9:127522059-127522081 CACCAGGCCAGGGGCTGGGGAGG No data
1060937066_1060937083 23 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937083 9:127522062-127522084 CAGGCCAGGGGCTGGGGAGGCGG No data
1060937066_1060937080 17 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937080 9:127522056-127522078 TGGCACCAGGCCAGGGGCTGGGG No data
1060937066_1060937079 16 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937079 9:127522055-127522077 ATGGCACCAGGCCAGGGGCTGGG No data
1060937066_1060937071 -3 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937071 9:127522036-127522058 GCCTTGGAAACCTGGAGAGATGG No data
1060937066_1060937078 15 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937078 9:127522054-127522076 GATGGCACCAGGCCAGGGGCTGG No data
1060937066_1060937076 10 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937076 9:127522049-127522071 GGAGAGATGGCACCAGGCCAGGG No data
1060937066_1060937073 4 Left 1060937066 9:127522016-127522038 CCAGGCCAGGTCAGCCGTTAGCC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1060937073 9:127522043-127522065 AAACCTGGAGAGATGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060937066 Original CRISPR GGCTAACGGCTGACCTGGCC TGG (reversed) Intronic
900408346 1:2502195-2502217 GGCTAACGGAGGGCCGGGCCGGG - Exonic
900568809 1:3348342-3348364 TACTAACGAGTGACCTGGCCAGG - Intronic
900793777 1:4695400-4695422 GGCCAACGGCTGGCCAGGCAAGG + Intronic
901044187 1:6385738-6385760 GGCTCACTGCTGAGCCGGCCAGG - Exonic
906146946 1:43565908-43565930 GGCTACCGGCTGGCCTGGAGCGG + Intronic
1063663505 10:8049013-8049035 GGCTCGCGGCTCTCCTGGCCTGG + Intergenic
1065318431 10:24486482-24486504 GGCAGACGGTTGACCTGTCCAGG - Intronic
1067143533 10:43676562-43676584 GGCCCAGTGCTGACCTGGCCCGG - Intergenic
1067686632 10:48469726-48469748 GGCTATGGGCTGCCCTTGCCAGG - Intronic
1070904687 10:80061565-80061587 AGCTAACTGCTGGCCGGGCCTGG + Intergenic
1084700013 11:70780337-70780359 GGCTCATGGCAGAGCTGGCCTGG - Intronic
1087761703 11:102110211-102110233 GGCGAAGGGCGGACCGGGCCAGG + Intergenic
1090604405 11:128406565-128406587 TGCAAACTGCTGACCTGCCCAGG + Intergenic
1093876054 12:24350637-24350659 GGTTAAAAGCTGACCAGGCCAGG - Intergenic
1099092100 12:78325162-78325184 GGATCAGGGCTCACCTGGCCAGG - Intergenic
1113639145 13:111944698-111944720 GGCAGGCGGCTGAGCTGGCCAGG - Intergenic
1119419453 14:74499645-74499667 GGCTATCAGCAGAGCTGGCCAGG + Exonic
1124373727 15:29117502-29117524 GGGTGACGGCTGCCCTGCCCCGG - Exonic
1130233376 15:82113444-82113466 GGCTAAAGACAGACCTGGCCTGG - Intergenic
1130989879 15:88869940-88869962 GGCTAAGGGCTGAGCTGGGCAGG - Intronic
1133228485 16:4354831-4354853 GTCTCACTGCTGACCTGGGCTGG - Exonic
1135155077 16:20045869-20045891 GGCTAGCGACTGCCTTGGCCAGG + Intronic
1142055826 16:87995243-87995265 GGCTGTGGGCTGCCCTGGCCTGG + Intronic
1145370582 17:22303514-22303536 GCCAAACGGGTGACTTGGCCAGG - Intergenic
1146208049 17:30921904-30921926 GGCTGGCGGCTGCCCAGGCCTGG + Exonic
1147560771 17:41507560-41507582 GGCTAACCCCTGACCCTGCCCGG + Intergenic
1203159863 17_GL000205v2_random:39254-39276 GGCTAAAGGGCCACCTGGCCTGG + Intergenic
1155442923 18:25880896-25880918 GGCCAAAGGCTGACATGACCAGG + Intergenic
1160376275 18:78414989-78415011 GCCTAGCAGCTGTCCTGGCCAGG - Intergenic
1161400343 19:4064485-4064507 GGCTTAGGCCTGGCCTGGCCTGG + Intronic
1162126017 19:8499887-8499909 AGCTGAGGGCTGACCGGGCCTGG - Intronic
1162480752 19:10925733-10925755 GGCTCACTGCTGCCCCGGCCTGG - Exonic
1163133346 19:15290643-15290665 GGCAAACAGCTAATCTGGCCAGG + Intronic
1165014296 19:32869636-32869658 GGCTCATGGCTCTCCTGGCCGGG - Intronic
1166841130 19:45697727-45697749 GGCTGGGGGATGACCTGGCCTGG - Intronic
926163357 2:10503110-10503132 TGCTAACAGCTGTCCTGGGCAGG - Intergenic
928429086 2:31203014-31203036 GGCTGCCTGCTGACCAGGCCTGG - Intronic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
929901352 2:46006347-46006369 GGATAACTGCTGAACTGGCAAGG + Intronic
941676347 2:168346994-168347016 AGCTTACAGCCGACCTGGCCTGG - Intergenic
1170475413 20:16709449-16709471 GGCTAATGGCTGAAGTGGCAGGG + Intergenic
1173757963 20:45534897-45534919 GGCTTCCGTCTGACCTGGTCTGG + Intronic
1173907680 20:46640765-46640787 AGCTAGGGGCAGACCTGGCCCGG - Intronic
1175345545 20:58271052-58271074 TGTTAACGTTTGACCTGGCCGGG - Intergenic
1177885783 21:26743681-26743703 GGCTATCAGCTGAGCTGGCCTGG + Intergenic
1178212464 21:30551931-30551953 GGCTAACAGCAGACCTTTCCAGG - Intronic
1183161047 22:36113336-36113358 AGCTAGAGGCTGACCTGGGCTGG - Intergenic
1184419269 22:44370157-44370179 GGCTCACAGGTGACCTAGCCTGG + Intergenic
950114335 3:10440818-10440840 GTCTAACAAGTGACCTGGCCAGG - Intronic
950535407 3:13575486-13575508 GTCTGACGGCTGATCTGGCAGGG - Intronic
950548461 3:13652855-13652877 AGCTCAAGGCTGACCTGGCTGGG + Intergenic
954901801 3:54026292-54026314 GGCTGAGTGCTGACCTGGTCCGG - Intergenic
969449748 4:7266218-7266240 GGCCAGCGGGTGGCCTGGCCTGG + Intronic
976447676 4:85150528-85150550 GGAAAAGGGCTGAGCTGGCCGGG + Intergenic
989458840 5:41672938-41672960 GCCTGAGGGCTGACCTGGGCTGG - Intergenic
998132337 5:139657732-139657754 GGCTGCCGGCTGGCCTGGGCTGG + Intronic
999327081 5:150650154-150650176 GGCTGCAGGCTGTCCTGGCCGGG - Exonic
1006268356 6:32944329-32944351 GGCTAACAGCTTACCTGGGCAGG - Intronic
1018901562 6:168054303-168054325 GCTTGACCGCTGACCTGGCCCGG + Intergenic
1019352347 7:560517-560539 GGCTTCCCCCTGACCTGGCCAGG + Intronic
1023653674 7:42397798-42397820 GGCTCACGGCTGCACTGCCCTGG - Intergenic
1023869156 7:44253571-44253593 GGCTAACGGAGGACCTCGCTAGG - Intronic
1024246920 7:47477631-47477653 AGCTATCAGGTGACCTGGCCAGG + Intronic
1032408198 7:131673152-131673174 AGCTCTCAGCTGACCTGGCCTGG - Intergenic
1035127435 7:156618677-156618699 GGCTGCTGGCTAACCTGGCCTGG - Intergenic
1035362397 7:158322212-158322234 GTCTCCCGGCTGTCCTGGCCTGG - Intronic
1040839765 8:51772538-51772560 TCCTCAGGGCTGACCTGGCCTGG - Intronic
1047949889 8:129923568-129923590 GACTAAAGGTTGACTTGGCCGGG - Intronic
1049245190 8:141558698-141558720 GGCTAAGGGGTGGCCTGGCTTGG - Intergenic
1057509063 9:95662736-95662758 GGCAAGCGGCTGTCCTGGGCGGG + Intergenic
1060937066 9:127522016-127522038 GGCTAACGGCTGACCTGGCCTGG - Intronic
1061163449 9:128909352-128909374 GGCTGGCGGGTGGCCTGGCCAGG + Intronic
1061289547 9:129642660-129642682 GGCTAGCAGCCGTCCTGGCCAGG - Intergenic
1062353913 9:136152949-136152971 GGCTCACCCGTGACCTGGCCTGG - Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186660486 X:11664381-11664403 GGCTACTGGCTGGCCCGGCCAGG + Exonic
1195583135 X:106531651-106531673 GGCTGTTGGCTGACCTGGGCAGG + Intergenic
1199724677 X:150568672-150568694 CGCTCACGGCTGGCCTGGCTCGG + Intronic