ID: 1060937549

View in Genome Browser
Species Human (GRCh38)
Location 9:127524441-127524463
Sequence ACTGCCCTCGGGGTGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060937549_1060937557 26 Left 1060937549 9:127524441-127524463 CCACACAACACCCCGAGGGCAGT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060937557 9:127524490-127524512 ACTGAAGAGGCTGAGATTCAGGG No data
1060937549_1060937558 27 Left 1060937549 9:127524441-127524463 CCACACAACACCCCGAGGGCAGT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060937558 9:127524491-127524513 CTGAAGAGGCTGAGATTCAGGGG No data
1060937549_1060937555 13 Left 1060937549 9:127524441-127524463 CCACACAACACCCCGAGGGCAGT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060937555 9:127524477-127524499 GTGCTTTGTAGACACTGAAGAGG No data
1060937549_1060937559 30 Left 1060937549 9:127524441-127524463 CCACACAACACCCCGAGGGCAGT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060937559 9:127524494-127524516 AAGAGGCTGAGATTCAGGGGAGG No data
1060937549_1060937556 25 Left 1060937549 9:127524441-127524463 CCACACAACACCCCGAGGGCAGT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1060937556 9:127524489-127524511 CACTGAAGAGGCTGAGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060937549 Original CRISPR ACTGCCCTCGGGGTGTTGTG TGG (reversed) Intronic
900117811 1:1035934-1035956 ACTGTCATCGGGGTGGTGTGAGG + Intronic
902575103 1:17372636-17372658 GCTGGCCTCGGGGGGCTGTGAGG + Intronic
904250341 1:29219048-29219070 ACTGCCCTCTGCTTGGTGTGGGG - Intronic
904567241 1:31435146-31435168 CCAGGCCTCGGGGTGCTGTGGGG + Intergenic
919755591 1:201064215-201064237 ACTGCCCTCAGGGGATTCTGGGG + Intronic
920306835 1:205023857-205023879 CCTTTCCTCGGGGTGGTGTGGGG + Intergenic
920543291 1:206795195-206795217 ACTGCCCTCAGACTGTTGTCAGG - Intergenic
922160126 1:223073540-223073562 ACTTCCCTCAGGTTGTTGTAGGG + Intergenic
1063233491 10:4088788-4088810 ACTTCCCTCATGGTGCTGTGAGG - Intergenic
1063933133 10:11049767-11049789 TGTGCACTCTGGGTGTTGTGGGG + Intronic
1065236789 10:23660291-23660313 ACTGGCCTCAGAGTGTTGTTAGG - Intergenic
1069092493 10:64218065-64218087 ACTGCACTAGGGGTATTGTAAGG - Intergenic
1070824069 10:79380781-79380803 GCTCTCCCCGGGGTGTTGTGTGG - Intergenic
1074291072 10:112138376-112138398 CCTGCCCTCGAGGAGTTGGGAGG + Intergenic
1075173038 10:120133634-120133656 TCTGCTCTCAGGCTGTTGTGGGG - Intergenic
1075633036 10:124012698-124012720 GCTACCCACAGGGTGTTGTGAGG - Intronic
1083753049 11:64772868-64772890 ATTGCCTTGGGGGTGTTGGGAGG - Intronic
1085197317 11:74680497-74680519 ACTTCCCAGGGGTTGTTGTGAGG + Intergenic
1089604769 11:119635532-119635554 ACGGCCTGCGGGGTGGTGTGTGG - Intronic
1090807004 11:130209137-130209159 AATGCCCGCGGGGTTCTGTGAGG - Intronic
1091843634 12:3638150-3638172 GCTGCCCTCGGGGGGATGTGGGG + Exonic
1094144690 12:27215893-27215915 ACTGACCTCAGGGTATTTTGGGG + Intergenic
1094173675 12:27520941-27520963 ACTGGCCTCTGGGTGTCTTGGGG - Intergenic
1095473911 12:42565836-42565858 ACTGCCCTCTGGGAGCTGCGAGG + Intronic
1096820853 12:54233060-54233082 GCAGCCCTCTGGGTATTGTGGGG - Exonic
1101995820 12:109524234-109524256 ACTGCCCACAGGGGGATGTGAGG - Intronic
1104066436 12:125310731-125310753 ACTACCGTGGGGGTGTTGTTGGG - Intronic
1106194721 13:27483494-27483516 GCTGCTCATGGGGTGTTGTGAGG + Intergenic
1109184609 13:59253451-59253473 ACTGCCCTCAGGGTTTTCTCTGG - Intergenic
1114243417 14:20890747-20890769 ACTGTCCTCGGTGTGTTTTTAGG + Intergenic
1114246394 14:20918666-20918688 ACTGTCCTCGGTGTGTTTTTAGG + Intergenic
1114250356 14:20954798-20954820 ACTGTCCTCGGTGTGTTTTTAGG + Intergenic
1122091518 14:99343930-99343952 ACAGCCTTCGAGGTCTTGTGTGG - Intergenic
1125674104 15:41493617-41493639 CCTGCCCTCGGGGAGGTGGGAGG - Intronic
1128305895 15:66598755-66598777 ACTGCCCTCAGAGTGCTGGGAGG + Intronic
1132054969 15:98644070-98644092 CCTGCCCTTGGGGTGCTCTGTGG + Intergenic
1136502635 16:30680517-30680539 CCTGCCCTCAGGGTGTAGGGTGG - Intergenic
1138458357 16:57133832-57133854 CCTTCCATTGGGGTGTTGTGAGG + Intronic
1139348417 16:66320078-66320100 ACTGCCCTGAGGGTGAAGTGAGG + Intergenic
1148438098 17:47697551-47697573 ACTGCCCTTGGGAGGCTGTGAGG + Intronic
1149598552 17:57878423-57878445 ACTGCTCTGGGGCTGTTCTGGGG + Intronic
1149773958 17:59342838-59342860 ACTGTCCTGGGGGTTTTGTGGGG + Intronic
1152500369 17:80704304-80704326 GCTGCCCTTGGTGTGTTGTATGG + Intronic
1156603181 18:38634870-38634892 TCTGCCATCAGGCTGTTGTGGGG + Intergenic
1162086877 19:8254649-8254671 ACTGCCCTGGGGGTGGGGCGTGG + Intronic
1164611757 19:29637099-29637121 ACTGCTCCCGGGGTGTGGGGAGG + Intergenic
1165247200 19:34504602-34504624 ACTGCTCTTGGGGGGCTGTGTGG + Exonic
1168702907 19:58452081-58452103 CCTGCCCTGGGGGGGTTGCGGGG + Intronic
1168705398 19:58467603-58467625 CCTGCCCTGGGGGGGTTGCGGGG + Exonic
925872918 2:8286169-8286191 GCTGCCCTGGGTTTGTTGTGAGG - Intergenic
931259923 2:60608457-60608479 ACTTCCATAGGGCTGTTGTGAGG - Intergenic
934853367 2:97714854-97714876 ACTGCCCTGGCAGTGTTGCGGGG + Intronic
935462299 2:103352570-103352592 ACTGCCTTTGGGGTGTTTGGTGG + Intergenic
935902196 2:107805109-107805131 TCTGCCATGGGGGTTTTGTGAGG - Intergenic
936662731 2:114560203-114560225 ACTGCCCTGTGGGAGTTGGGAGG + Intronic
937811959 2:126209471-126209493 TCTGCCATAGGGTTGTTGTGAGG - Intergenic
944552447 2:200857046-200857068 ACTGCACCCGGCCTGTTGTGGGG - Intronic
947048708 2:226018485-226018507 AGTGCCCTGGTGGTGCTGTGTGG + Intergenic
949041377 2:241851435-241851457 ACTGCCCTCTGTGTGATCTGGGG + Intronic
1172101333 20:32485026-32485048 ACTGCCCTCGTGGAATTCTGTGG + Intronic
1172885949 20:38231013-38231035 CCTGCCATCGGGGGGTTGTCAGG - Intronic
1174454447 20:50639452-50639474 CCTGCCCCCGGGGAGCTGTGGGG - Intronic
1174472349 20:50770273-50770295 CCTGCCCCCGGGGAGCTGTGGGG + Intergenic
1175914404 20:62419004-62419026 ACTGGACTGGGGGTGGTGTGGGG + Intronic
1180694385 22:17742586-17742608 ACTGCCCTCTGGTGGCTGTGGGG - Intronic
1181133248 22:20746844-20746866 AGTGCCCTCTGGCTTTTGTGGGG - Intronic
1181463908 22:23100627-23100649 CCTGCCCTCGTGGTGTGCTGAGG - Intronic
1183511606 22:38238597-38238619 ACTGGCCTCTGGCTCTTGTGTGG + Intronic
1185197486 22:49481441-49481463 CCTGACCTCGGGGTGATGTGGGG + Intronic
1185294360 22:50046079-50046101 TCCGCCCTAGGGGTGCTGTGTGG - Intronic
950136217 3:10582820-10582842 GCTGCCCTTGGTGTCTTGTGTGG - Intronic
950460121 3:13116141-13116163 ACTGCCCTCAGGGAGCTGGGAGG - Intergenic
954002112 3:47565994-47566016 TCTGCCCTCAGGCTGATGTGCGG - Intronic
954369921 3:50164871-50164893 ACTGGCCTCGTTGTGTTGTCAGG + Intronic
954900544 3:54015374-54015396 ACCTCCCTCAGGGAGTTGTGTGG - Intergenic
955322674 3:57985612-57985634 ACAGCCCTCGTGGTGGAGTGAGG + Intergenic
955746186 3:62142587-62142609 ACTCCCCTTTGGTTGTTGTGAGG - Intronic
957304630 3:78441597-78441619 ACAGCCCTCTGGGTGGTTTGGGG - Intergenic
961010102 3:123429905-123429927 GCTGCCCTGGGGGTGGGGTGTGG + Intronic
961027220 3:123568889-123568911 ACTGCCCTGGGCAAGTTGTGTGG - Intronic
961645938 3:128392838-128392860 CGTGCCCTCGGGCTGGTGTGGGG + Intronic
964550099 3:157876067-157876089 ACTTCCGTCTGGCTGTTGTGTGG - Intergenic
964704196 3:159601245-159601267 ACTACCCTCTGGGTCTTGAGTGG + Intronic
969086989 4:4663997-4664019 CCTGCCCTCAGGTGGTTGTGAGG + Intergenic
969525911 4:7703959-7703981 ACTGCCCTGGGGGTGTTTTCTGG - Intronic
969716239 4:8869638-8869660 ACTCCCCTGTGGGTGCTGTGAGG - Intronic
976192352 4:82500013-82500035 TCTGCCCTGGGGAGGTTGTGAGG - Intronic
986514292 5:8544201-8544223 GCTGCACTCTGGGTGCTGTGTGG + Intergenic
995985812 5:118172148-118172170 ACTGTCTTTGGGGTGTTGGGAGG + Intergenic
1000603087 5:163298248-163298270 ACTGACTTAGTGGTGTTGTGGGG - Intergenic
1001722379 5:173867210-173867232 CCTGCCCTCGAGGTGTTGAGAGG - Intergenic
1006036194 6:31214611-31214633 ACTGCCCTCAGGGGGCTCTGTGG + Intergenic
1017058077 6:150455788-150455810 ACTGCCCTCGTGGTGAAGTCAGG - Intergenic
1019115692 6:169760159-169760181 CATGCCCTGGGGTTGTTGTGGGG + Intronic
1019724760 7:2595399-2595421 ACTGCCCTCTGGGTGGGGTGGGG + Intronic
1020117929 7:5486880-5486902 CCTGGCCCCGGGCTGTTGTGCGG - Intronic
1023662128 7:42480598-42480620 TCTGCCCACAGGGTTTTGTGAGG - Intergenic
1026827833 7:73595360-73595382 ACTGCCCTCGGGGCTTCCTGAGG + Intronic
1028604580 7:92642103-92642125 ACTGCCCTCTGGATTCTGTGAGG + Intronic
1029676987 7:102076623-102076645 GATGCCCTGGGGGTGTGGTGTGG - Intronic
1033494112 7:141876777-141876799 ACTGCAATGGGGGTCTTGTGGGG + Intergenic
1033589354 7:142797081-142797103 ACTGCGCTCGGGTTTTTGTGCGG + Intergenic
1035135629 7:156700374-156700396 ACTCACCTCGGACTGTTGTGGGG + Intronic
1035317251 7:158003782-158003804 ACTGGCCTTGGCGTGTTGGGAGG - Intronic
1036048690 8:5171799-5171821 AATTCCTTCGGGCTGTTGTGTGG + Intergenic
1038444143 8:27591968-27591990 ACTTCCATCGGGTTGGTGTGCGG - Intergenic
1042342749 8:67697179-67697201 ACTGCCCTCGTGGTGTTCCCAGG - Intronic
1048052636 8:130832851-130832873 ATTGCCCTAGGGCTGCTGTGAGG - Intronic
1056186052 9:84135918-84135940 ACTGGTGTCTGGGTGTTGTGCGG + Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1060937549 9:127524441-127524463 ACTGCCCTCGGGGTGTTGTGTGG - Intronic
1061169594 9:128944580-128944602 ACACCTCGCGGGGTGTTGTGAGG - Intronic
1061327868 9:129875087-129875109 ACAGCCCTCTGGCTGCTGTGGGG + Intronic
1061420550 9:130471006-130471028 CCTGCCCTCGGGGAGCTGAGAGG + Intronic
1061545889 9:131304066-131304088 CCTGCCCTGGGGGTGCTGTCTGG + Intronic
1062560970 9:137141727-137141749 ACTGCCCTTGGGATGTCCTGGGG - Intronic
1062583904 9:137240512-137240534 ACTGCCCTCGCGGTCGCGTGAGG - Intergenic
1190243916 X:48677983-48678005 CCTGCCCTCGGGGTGTGTTTTGG + Intronic
1190308916 X:49102703-49102725 CCTGCCCTCGGGGTGTGTTTTGG + Intergenic
1196144207 X:112298730-112298752 ACTGCCCTTTGGGGGTAGTGGGG + Intergenic
1196911792 X:120491203-120491225 ATTGCCTTCTGGGTTTTGTGTGG - Intergenic
1199428787 X:147735088-147735110 ACTGCCTCAGGGGTTTTGTGGGG - Intergenic
1201273988 Y:12281942-12281964 TTTGCCCTGGGGGAGTTGTGTGG + Intergenic