ID: 1060938250

View in Genome Browser
Species Human (GRCh38)
Location 9:127528191-127528213
Sequence CTGGGGATGGGGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060938240_1060938250 0 Left 1060938240 9:127528168-127528190 CCAATCCTCAGGGACTGACTTAT 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG No data
1060938242_1060938250 -5 Left 1060938242 9:127528173-127528195 CCTCAGGGACTGACTTATCTGGG 0: 1
1: 0
2: 1
3: 3
4: 146
Right 1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG No data
1060938239_1060938250 3 Left 1060938239 9:127528165-127528187 CCTCCAATCCTCAGGGACTGACT 0: 1
1: 0
2: 2
3: 10
4: 154
Right 1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060938250 Original CRISPR CTGGGGATGGGGAAGGAGAA GGG Intronic
No off target data available for this crispr