ID: 1060938282

View in Genome Browser
Species Human (GRCh38)
Location 9:127528429-127528451
Sequence TCAGATGCACTCATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060938280_1060938282 0 Left 1060938280 9:127528406-127528428 CCTTTTGCAAAAAGAAACATTTC 0: 1
1: 0
2: 5
3: 54
4: 623
Right 1060938282 9:127528429-127528451 TCAGATGCACTCATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060938282 Original CRISPR TCAGATGCACTCATGGAGAA AGG Intronic
No off target data available for this crispr