ID: 1060940341

View in Genome Browser
Species Human (GRCh38)
Location 9:127539797-127539819
Sequence CCCTGTTTGCAGGTGATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060940341_1060940348 -7 Left 1060940341 9:127539797-127539819 CCCCCCATCACCTGCAAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1060940348 9:127539813-127539835 AACAGGGCACCATTTCTACATGG No data
1060940341_1060940351 8 Left 1060940341 9:127539797-127539819 CCCCCCATCACCTGCAAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1060940351 9:127539828-127539850 CTACATGGACACACAGGCTCTGG No data
1060940341_1060940352 9 Left 1060940341 9:127539797-127539819 CCCCCCATCACCTGCAAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1060940352 9:127539829-127539851 TACATGGACACACAGGCTCTGGG No data
1060940341_1060940350 2 Left 1060940341 9:127539797-127539819 CCCCCCATCACCTGCAAACAGGG 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1060940350 9:127539822-127539844 CCATTTCTACATGGACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060940341 Original CRISPR CCCTGTTTGCAGGTGATGGG GGG (reversed) Intronic
900244981 1:1632523-1632545 CCCTGTGTCCAGTTGTTGGGAGG + Intronic
900256212 1:1699682-1699704 CCCTGTGTCCAGTTGTTGGGAGG + Intronic
900462205 1:2807090-2807112 TGCTGTTAGCAGGTGATGGCTGG + Intergenic
901086245 1:6613924-6613946 CCCGGGCTGGAGGTGATGGGGGG - Exonic
901955082 1:12778232-12778254 CCCTGTTTACTCCTGATGGGTGG + Intergenic
903265566 1:22156044-22156066 CCCTGTCTGCAGCTGGAGGGTGG + Intergenic
904612034 1:31731192-31731214 CCCTGTTTACATGTGTGGGGAGG - Exonic
904778035 1:32923913-32923935 CCCAGTTGGGAGGCGATGGGCGG + Intergenic
904796607 1:33061017-33061039 CCCTGTGTGCAGCTGCTGTGGGG - Intronic
909479446 1:76115735-76115757 ACCAATTGGCAGGTGATGGGTGG - Intronic
914343033 1:146776452-146776474 CCCTGGTTGCAGGGGTGGGGGGG - Intergenic
915440609 1:155943242-155943264 CCCTGTTTTGAGGTGGGGGGTGG - Intergenic
915767174 1:158374407-158374429 CCCTCATTGCAGGGGAGGGGGGG + Intergenic
916472423 1:165137274-165137296 CTCTGTGGGCAGGTGGTGGGAGG + Intergenic
916584852 1:166141652-166141674 TCCAGCTTGGAGGTGATGGGAGG + Intronic
917073614 1:171179881-171179903 CCATGCTGGGAGGTGATGGGTGG + Intergenic
919794560 1:201313505-201313527 TCCTTGTTGCAGGAGATGGGCGG - Exonic
920981393 1:210839418-210839440 GCCTGTTGGAAGGTGAGGGGTGG + Intronic
922222700 1:223620579-223620601 CCCTGTTTGCAGGAATGGGGAGG + Intronic
1063378746 10:5570875-5570897 TCCTGTGTGCAGGTGCTGGCTGG - Intergenic
1063629909 10:7723578-7723600 CCTTGTTTGCAGTGGTTGGGGGG + Intronic
1065471900 10:26090875-26090897 TCCTGTCTGCAGGTGGAGGGAGG + Intronic
1065735161 10:28744940-28744962 CCCTGTATGGATGAGATGGGTGG + Intergenic
1069089308 10:64180102-64180124 CCCTGGTTGCAGACGGTGGGTGG + Intergenic
1072909062 10:99483996-99484018 CCCTGTCTGCTGGAGAGGGGAGG - Intergenic
1073475204 10:103748046-103748068 CCATCCTTGCAGGAGATGGGTGG - Intronic
1074766113 10:116701119-116701141 CCTTGGTGGCAGGCGATGGGAGG - Exonic
1075072418 10:119327739-119327761 CCATGTTTATAGGTGATAGGAGG + Intronic
1075077268 10:119359730-119359752 CCCTGGATGCAGGTGTTCGGGGG + Intronic
1076498553 10:130915933-130915955 GCTTGTTTGCAGGAGATGAGGGG + Intergenic
1077172732 11:1175210-1175232 CCATGTGTGCAGGTGCTGTGAGG - Intronic
1080876261 11:36277221-36277243 TCCTGTTAGCAGGTGATGACAGG - Intronic
1081625905 11:44654938-44654960 GCCTGGGTGCAGGTGGTGGGTGG - Intergenic
1081812393 11:45921458-45921480 CCCCCTTTCCAGGTCATGGGAGG + Intergenic
1083659074 11:64243895-64243917 GGCTGGCTGCAGGTGATGGGAGG - Intronic
1084192857 11:67506707-67506729 CACTGTCGGCAGGTCATGGGTGG + Exonic
1084256224 11:67944714-67944736 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1084816533 11:71650585-71650607 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
1085014039 11:73160689-73160711 TCCTGTGTGCAGGTGCTGGCTGG + Intergenic
1085473647 11:76774185-76774207 CCCAGTTTGGTGGTGGTGGGAGG - Intergenic
1087632782 11:100670297-100670319 CCCTGTGGGCAGGAGATTGGTGG - Intergenic
1088367755 11:109056916-109056938 TCCTGCTTGAAGGGGATGGGTGG + Intergenic
1089632198 11:119790778-119790800 CCGTGTGTGCATGTGGTGGGGGG + Intergenic
1091599569 12:1909597-1909619 CCCTGTCTGCAGGAGTTTGGGGG + Intronic
1091893404 12:4081323-4081345 CCCTATTTGCAGATGAGGGTGGG + Intergenic
1092426456 12:8379445-8379467 CCCTGTTAGCAGGGGTTGGGGGG + Intergenic
1092443767 12:8534035-8534057 GCCTGTTTGGAGCTGATGGCTGG + Exonic
1095841803 12:46701741-46701763 TCCTGCTTGCAGATGATTGGAGG - Intergenic
1097380736 12:58893076-58893098 CCCACTTTGCAGGTGAGAGGAGG + Intronic
1098357151 12:69622635-69622657 TCTTGTTTCCAGATGATGGGAGG - Intergenic
1099428966 12:82557947-82557969 GCCTGTTGGAAGGTGAGGGGTGG - Intergenic
1104085399 12:125470264-125470286 CACTGTCTGCAGTTGATGGTTGG - Intronic
1104933993 12:132354953-132354975 CCCTGAGTGCAGGTGCAGGGTGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105991843 13:25630079-25630101 CCCTGTTTGGTGGTGGGGGGGGG - Intronic
1112521519 13:100099675-100099697 CCCTGTTTGCAGTGGCTGGAAGG + Intronic
1118315320 14:64722531-64722553 CCCTGTGTGCAGGTGCCGTGTGG + Intronic
1118702237 14:68444789-68444811 ACCAGTTTTCTGGTGATGGGGGG + Intronic
1119784082 14:77299551-77299573 CTCTGTTTGCAGGTGACTGTGGG - Exonic
1119932470 14:78561592-78561614 CCCTGTTTGAAGGAGATGTGTGG - Intronic
1124830537 15:33144998-33145020 CCCTGATTGCAGTTGCTGGAAGG - Intronic
1125374226 15:39011693-39011715 TGCTGTTGGCAGGTGGTGGGGGG - Intergenic
1125408700 15:39382228-39382250 CCCTGTTTGAGGGTGGAGGGTGG + Intergenic
1125889204 15:43253171-43253193 CCAGCTTTGCAGGGGATGGGAGG - Intronic
1126917171 15:53478569-53478591 ATCTGTTTGAAGGTAATGGGAGG - Intergenic
1128784598 15:70385513-70385535 CCCTATTTGCAGGTAATAGGAGG + Intergenic
1130247348 15:82263493-82263515 CTGTGTTTACAGGTGATGGAAGG - Intronic
1131208533 15:90472990-90473012 ACCTGAATGCAGGTGATGGCAGG - Exonic
1131948984 15:97660127-97660149 GCCTGTGTGCAGGTTAGGGGAGG + Intergenic
1133255442 16:4513419-4513441 CCTTGTGTGCAGGAGAGGGGTGG - Intronic
1133371839 16:5251128-5251150 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
1133415897 16:5606790-5606812 CACTGATTGCAGGAGATGGGGGG + Intergenic
1136270592 16:29146137-29146159 ACCTGTGTGCAGGGCATGGGAGG - Intergenic
1136398604 16:30005940-30005962 CCGGGTGTGCAGATGATGGGGGG + Exonic
1138492389 16:57384035-57384057 CCCTCTTAGCGGGTGATGGGAGG - Exonic
1139439558 16:66959225-66959247 CTGTGTTTGCAGCTGATGGGAGG + Intergenic
1139990953 16:70938876-70938898 CCCTGATTGCAGGGGTGGGGGGG + Intronic
1140791149 16:78392345-78392367 CCCATCTTGAAGGTGATGGGAGG - Intronic
1141262195 16:82463983-82464005 GCCTGTTTACAGGTGAGGGCAGG - Intergenic
1142074181 16:88107948-88107970 ACCTGTGTGCAGGGCATGGGAGG - Intronic
1143032619 17:3976372-3976394 TCCTGTGTGCAGGGGCTGGGGGG + Intergenic
1143663024 17:8338954-8338976 CCCAGTGTGGTGGTGATGGGAGG - Intergenic
1144819837 17:18064602-18064624 CCCTGTTGGCAGGTGATCCAGGG - Intronic
1145884114 17:28371098-28371120 CACTTTTTTCAGGTGATGGGAGG - Intronic
1146426031 17:32739917-32739939 CACTGCTTGCTGGTGATGGTGGG - Intronic
1147659067 17:42107593-42107615 CCCTGTTCGATGGTGAGGGGCGG - Exonic
1148688638 17:49514282-49514304 CCATGTTTGCAGGGAAGGGGAGG - Exonic
1150272662 17:63876655-63876677 TCCTCTTTGCTGGTGCTGGGAGG - Intronic
1150646714 17:66983238-66983260 ACCTGGGTGCAGGTGCTGGGGGG - Intronic
1152756037 17:82087494-82087516 CCCTGTGTGCAGGTGACTCGGGG - Exonic
1153261104 18:3225387-3225409 CCCTGTTCACAGGAGAAGGGAGG + Intergenic
1156469579 18:37368903-37368925 CCCTGTTTGGGGGAGATGTGTGG + Intronic
1158000442 18:52612299-52612321 GCATGTTGGCAGGGGATGGGGGG - Intronic
1158443639 18:57499994-57500016 CCCTTTCTGGAGGTGATGGATGG - Intergenic
1160612147 18:80096815-80096837 CCCTGCAAGCTGGTGATGGGCGG - Exonic
1160986079 19:1839566-1839588 ACCTGTGTGCAGATGCTGGGGGG + Intronic
1161638592 19:5405334-5405356 CCCTGCTTCCAGGTGTTTGGGGG - Intergenic
1163126317 19:15246129-15246151 CCCTGTATGCAGGTTTTAGGCGG - Intronic
1164149916 19:22541901-22541923 ATCTGTTTGCAGCTGATGGGAGG - Intergenic
1164685987 19:30167243-30167265 CCCTGCCTGCAGCTGATGTGTGG + Intergenic
1164873988 19:31670372-31670394 ACCTGTTTGCATGTGATTGGTGG - Intergenic
1166090005 19:40502758-40502780 CCATGCCTGCAGGAGATGGGAGG - Exonic
1166369311 19:42292455-42292477 CCCTGCTCTCAGGTGAGGGGCGG + Exonic
1166988233 19:46675022-46675044 CCCTGGTTACAGGTGATGCAGGG - Exonic
1167219138 19:48186248-48186270 CCCTGCTTGCTGGGGGTGGGGGG - Intronic
1168493386 19:56829940-56829962 ACGTGTTTGCAGGTGCTGAGAGG + Intronic
925812188 2:7711636-7711658 CCTGGTTTGCAGGTGGAGGGTGG - Intergenic
931119332 2:59199108-59199130 CCCTCTTGGCCTGTGATGGGAGG - Intergenic
931463762 2:62469613-62469635 GCCTGTTGCCAGGTGTTGGGAGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
936702525 2:115030636-115030658 GCCTGTTTGAAGGTGAGGAGTGG - Intronic
936758907 2:115749850-115749872 ACCTGTCTGCAGGTGATGCTGGG + Intronic
937453902 2:122025084-122025106 CCCTTTTTGCTGGTCTTGGGTGG + Intergenic
938958113 2:136317407-136317429 CCTTGTTTCCAGGTGAGAGGAGG + Intergenic
944618544 2:201487212-201487234 CCCAGTTTTCAGGTGATTTGTGG - Intergenic
946361081 2:219219661-219219683 TCCCATGTGCAGGTGATGGGGGG + Exonic
946569966 2:221013757-221013779 CAGTGTTGGCATGTGATGGGTGG - Intergenic
948119441 2:235518020-235518042 CCCCATTTGCAGGTGAGAGGTGG + Intronic
948645919 2:239404453-239404475 CCCAGTTTGGAGGGGAAGGGGGG + Intergenic
1168869842 20:1118810-1118832 TCCTGCCTGCAGGTGATGGCCGG - Exonic
1168974828 20:1956436-1956458 CCCTGTGGGCAGGTAGTGGGTGG - Intergenic
1170270586 20:14523245-14523267 CTCTGTCTGCTGGTGATTGGAGG - Intronic
1171380723 20:24732155-24732177 CCCTGCTGGCTGGTGTTGGGTGG - Intergenic
1171490627 20:25514640-25514662 GCCTGTGAGCTGGTGATGGGAGG - Intronic
1173001535 20:39109380-39109402 TCTTGTTCGCAGGTGATGAGAGG + Intergenic
1173834656 20:46117660-46117682 GCCTGTCTCCAGGTGCTGGGTGG + Intergenic
1175521124 20:59603636-59603658 CCCCCTTTGCAGGTGCTGGAAGG - Intronic
1178348402 21:31851735-31851757 CCCAGTGTGGAGGTGTTGGGAGG - Intergenic
1178980170 21:37257353-37257375 CCCTGTTCGCAGGTGACGTGTGG + Intronic
1180699411 22:17773551-17773573 CCCTGCCTGCAGGTGAAGGCCGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1180910123 22:19444086-19444108 TCCTGCATGCAGGTGAGGGGTGG + Exonic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183453855 22:37910953-37910975 CCCTGACTGCCGGAGATGGGTGG - Intronic
1184692586 22:46123952-46123974 CCTTGTCTGGAGGTGATGGGCGG + Intergenic
1184717792 22:46291605-46291627 CACTGTTTTCAGGTGTTTGGGGG + Intronic
1185208100 22:49551744-49551766 CCCTGCTCGCAGGCGCTGGGTGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
950695924 3:14701175-14701197 CCCTGTTGGCAGGAGAAGTGGGG + Intronic
954461675 3:50630340-50630362 ACATGTTTGCAGGAGTTGGGAGG + Intronic
956742942 3:72289225-72289247 CCCAGTTTGCAGGAGGTGGGAGG - Intergenic
959202979 3:103271786-103271808 CCCTCTTGGCCTGTGATGGGAGG + Intergenic
960267048 3:115632166-115632188 CCCAGTTTGGAGGTGAAGTGGGG - Intronic
961282976 3:125777973-125777995 CCCTGTTAGCAGGGGCTGGGGGG - Intergenic
963214731 3:142732287-142732309 CCCTGTCTTCAGGTGTTGGCTGG + Intronic
965416944 3:168407747-168407769 CCCTGTATGAGGGTGAAGGGGGG - Intergenic
965689378 3:171339147-171339169 ACCTGGTTGTAGGAGATGGGAGG - Intronic
965911047 3:173776238-173776260 CACAGTTTGCAGATGATAGGTGG - Intronic
966213699 3:177479132-177479154 GCCTGGTGGCAGGTGCTGGGAGG + Intergenic
968585524 4:1414459-1414481 GCCTGTCTGCAGGAGGTGGGTGG + Intergenic
968585565 4:1414581-1414603 GCCTGTCTGCAGGAGGTGGGTGG + Intergenic
968859439 4:3154699-3154721 CCCTGGTTGCAGGTGATGGCTGG + Intronic
969055032 4:4396386-4396408 CCCTGTTTGCCTGTGATGTGAGG + Intronic
969345272 4:6565891-6565913 GCCTGTTTGCAGTTGCTGGAAGG + Intergenic
969739200 4:9011992-9012014 CCCTATTAGCAGGGGCTGGGGGG - Intergenic
969798388 4:9543505-9543527 CCCTGTTAGCAGGGGCTGTGGGG - Intergenic
970689575 4:18607009-18607031 CCCTGTCTTCAGGTGTTGGCTGG + Intergenic
973687637 4:53389111-53389133 CAGTGTTTGCCGGTGGTGGGTGG - Intronic
975417456 4:74121496-74121518 TCCCATGTGCAGGTGATGGGAGG - Intronic
975617258 4:76258604-76258626 CCCAGTGTCCAGGTGATGGGAGG + Intronic
980897261 4:138871927-138871949 GCCTGTTGGCAGGTGTAGGGTGG - Intergenic
986243925 5:5988043-5988065 CCCAGTGTGGTGGTGATGGGAGG - Intergenic
986533357 5:8761619-8761641 GCCTCTTTGCCTGTGATGGGAGG - Intergenic
987708138 5:21481437-21481459 CCCTGCTTGCAGGTGTGAGGGGG + Intergenic
991443860 5:66679429-66679451 CCCTGTTGGCAGGTGTAGGCTGG + Intronic
993761703 5:91803293-91803315 CCCTGGCTGCAGGGGATGTGTGG - Intergenic
994818862 5:104622257-104622279 CTCTGTTTGCTGGTGGTGGAAGG - Intergenic
996703454 5:126472840-126472862 TCCTGTTTGAAGGTCATGGCAGG - Intronic
997294137 5:132759466-132759488 CCCTGTCTGCAGTTGCTGAGTGG + Intronic
998413458 5:141928496-141928518 CCTTGGTTGGAGGTGATGGGAGG - Intronic
999148478 5:149411235-149411257 CCCTGTGCCCAGGTGATGAGGGG + Intergenic
999256262 5:150211430-150211452 CCCTGCCTGCAGGTGAAGGCTGG + Intronic
1000587349 5:163116994-163117016 GCCTGTTGTCAGGTGGTGGGAGG - Intergenic
1001363785 5:171116315-171116337 CCCTCTTTGTAGAAGATGGGAGG - Intronic
1003286224 6:4735889-4735911 GCATGTGTGCACGTGATGGGGGG + Intronic
1004842741 6:19605899-19605921 CCCAGTGTGCTGGTGTTGGGAGG - Intergenic
1007295629 6:40818670-40818692 CCCTGATGACAGGTGATGTGGGG + Intergenic
1009324189 6:62329656-62329678 GCGTGTTTGCAGGCGGTGGGTGG - Intergenic
1010265689 6:73863329-73863351 ACTTGTTTACTGGTGATGGGTGG - Intergenic
1011718285 6:90129442-90129464 GCCTGTTGGGAGGTGAGGGGAGG - Intronic
1014529816 6:122545592-122545614 CCCTATTTGTGGGTGAAGGGTGG - Intronic
1017786648 6:157762196-157762218 GCCAGTTGGCAGGTGATGGTGGG - Intronic
1019765024 7:2843816-2843838 ACCTGGGTGCAGGTGCTGGGCGG + Intronic
1019893571 7:3965908-3965930 GCATGTGTGCAGGTGAAGGGAGG + Intronic
1020617488 7:10477114-10477136 CAATGTTGGCAGGTCATGGGTGG - Intergenic
1023680897 7:42686044-42686066 CCCTGTGTGCATGTGTGGGGTGG + Intergenic
1029073412 7:97918078-97918100 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1035741646 8:1932396-1932418 CCCTGTGTGCATGTGACGGCAGG + Intronic
1035879888 8:3234595-3234617 CAGTCTTTGCAGCTGATGGGAGG - Intronic
1036244277 8:7103212-7103234 ACCTGTTAGCAGGGGCTGGGGGG - Intergenic
1036897556 8:12648197-12648219 CCCTGTTAGCAGGGGCTGGGGGG + Intergenic
1038394258 8:27235431-27235453 TCATGTTTGCAGGGGAAGGGAGG + Exonic
1038479412 8:27891614-27891636 CCCTGTCTTCAGGTGTTGGCTGG - Intronic
1044004534 8:86925527-86925549 CCCTGTCTGTATGTGATGGTGGG + Intronic
1048600569 8:135915168-135915190 GCCTGTTTGAAGGTGGAGGGTGG + Intergenic
1049564466 8:143331077-143331099 CTCTTCTTGCAGGTGATGCGTGG - Intronic
1050526482 9:6550904-6550926 CCTTTGTTGCAGATGATGGGAGG - Exonic
1051555022 9:18373582-18373604 CCCTGTTGGCAGATAATGGAAGG - Intergenic
1051750138 9:20332722-20332744 TCCTGTTTGCAGGAGATGCTAGG + Intergenic
1053753754 9:41281055-41281077 CACTGTCTGCAGGTCATGGGTGG - Intergenic
1054259277 9:62845415-62845437 CACTGTCTGCAGGTCATGGGTGG - Intergenic
1054332502 9:63774622-63774644 CACTGTCTGTAGGTCATGGGTGG + Intergenic
1055003712 9:71482499-71482521 GTCTGTTTGGAGGTGTTGGGTGG + Intergenic
1056154694 9:83822631-83822653 CCCTAGATGAAGGTGATGGGAGG - Intronic
1057764746 9:97907009-97907031 CACTGTATACAGTTGATGGGAGG - Intronic
1058562392 9:106243697-106243719 CCCAGTTTGCAGATGATGATCGG + Intergenic
1059349159 9:113652184-113652206 CCCTGATGGCAGGTGGTAGGAGG - Intergenic
1059666191 9:116448425-116448447 CCCTCACTGCAGGAGATGGGAGG - Intronic
1060269679 9:122131823-122131845 CGCTGATTGCAGGAGATGGCAGG - Intergenic
1060940341 9:127539797-127539819 CCCTGTTTGCAGGTGATGGGGGG - Intronic
1061268132 9:129520300-129520322 CTCTCTGTGCAAGTGATGGGAGG - Intergenic
1061878381 9:133556186-133556208 CTATGTGTGCAGCTGATGGGGGG + Intronic
1062051620 9:134450214-134450236 CCCTGCTTGCTGCTGAGGGGAGG + Intergenic
1062674137 9:137730260-137730282 CCCTGGTGGGATGTGATGGGAGG - Intronic
1202799508 9_KI270719v1_random:162933-162955 CACTGTCGGCAGGTCATGGGTGG + Intergenic
1186551689 X:10512641-10512663 CCATCTTTGCAGGTGTTGGAAGG - Intronic
1186900139 X:14045703-14045725 CCCACTTTGGAGTTGATGGGAGG + Intergenic
1189267218 X:39726055-39726077 CCCTGTGTGCAGGGGCTGGCAGG + Intergenic
1194207569 X:91030000-91030022 TCCTGTTTCCAGGTGATGAATGG - Intergenic
1195290312 X:103425907-103425929 TCCTGTCATCAGGTGATGGGAGG + Intergenic
1196776490 X:119342880-119342902 CCCAGTTTGATGGTGTTGGGAGG - Intergenic
1197516092 X:127431433-127431455 GCCTGTTGGGAGGTGGTGGGGGG - Intergenic
1200553366 Y:4605046-4605068 TCCTGTTTCCAGGTGATGAACGG - Intergenic