ID: 1060940601

View in Genome Browser
Species Human (GRCh38)
Location 9:127541002-127541024
Sequence CAGGTCCAGCATGGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060940587_1060940601 8 Left 1060940587 9:127540971-127540993 CCTGCCCGCCTGGTTCCCAGGGC 0: 1
1: 0
2: 2
3: 49
4: 401
Right 1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG No data
1060940595_1060940601 -8 Left 1060940595 9:127540987-127541009 CCAGGGCATAGGGAGCAGGTCCA 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG No data
1060940592_1060940601 0 Left 1060940592 9:127540979-127541001 CCTGGTTCCCAGGGCATAGGGAG 0: 1
1: 0
2: 1
3: 19
4: 230
Right 1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG No data
1060940594_1060940601 -7 Left 1060940594 9:127540986-127541008 CCCAGGGCATAGGGAGCAGGTCC 0: 1
1: 0
2: 3
3: 21
4: 175
Right 1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG No data
1060940589_1060940601 3 Left 1060940589 9:127540976-127540998 CCGCCTGGTTCCCAGGGCATAGG 0: 1
1: 0
2: 4
3: 16
4: 238
Right 1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG No data
1060940588_1060940601 4 Left 1060940588 9:127540975-127540997 CCCGCCTGGTTCCCAGGGCATAG 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1060940601 9:127541002-127541024 CAGGTCCAGCATGGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060940601 Original CRISPR CAGGTCCAGCATGGGGAGGT GGG Intronic
No off target data available for this crispr