ID: 1060941261

View in Genome Browser
Species Human (GRCh38)
Location 9:127544363-127544385
Sequence GCAACCTTGTGAGGTGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 298}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060941261_1060941271 26 Left 1060941261 9:127544363-127544385 CCACCACCACCTCACAAGGTTGC 0: 1
1: 0
2: 0
3: 29
4: 298
Right 1060941271 9:127544412-127544434 TGGCTTTTGTTGCTAACACCAGG No data
1060941261_1060941269 -3 Left 1060941261 9:127544363-127544385 CCACCACCACCTCACAAGGTTGC 0: 1
1: 0
2: 0
3: 29
4: 298
Right 1060941269 9:127544383-127544405 TGCTAGGGCAGGGAGCACTCAGG No data
1060941261_1060941270 6 Left 1060941261 9:127544363-127544385 CCACCACCACCTCACAAGGTTGC 0: 1
1: 0
2: 0
3: 29
4: 298
Right 1060941270 9:127544392-127544414 AGGGAGCACTCAGGAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060941261 Original CRISPR GCAACCTTGTGAGGTGGTGG TGG (reversed) Intronic
900728669 1:4236435-4236457 GCAACGATGTTAGGAGGTGGGGG + Intergenic
901206120 1:7496835-7496857 GCAGCCCTGGGAGGTGGTGTTGG - Intronic
902573091 1:17359401-17359423 CCAACATGGTGAGGAGGTGGCGG + Exonic
903365856 1:22805106-22805128 CCAGCCCTGGGAGGTGGTGGGGG - Intronic
903847740 1:26288529-26288551 GAACCCTGGTGGGGTGGTGGGGG - Intronic
904710660 1:32427306-32427328 GCAGCCTATTGTGGTGGTGGTGG + Intergenic
904822725 1:33256155-33256177 GCAACTTTGCCAGGCGGTGGCGG + Intergenic
906673988 1:47679976-47679998 CCAGCCTTGAGGGGTGGTGGAGG - Intergenic
907414003 1:54301758-54301780 GGAACCTAGGGTGGTGGTGGCGG - Intronic
907982071 1:59493171-59493193 GAAACCTTGTGCAGTGTTGGTGG + Intronic
909499912 1:76322748-76322770 CCAAACTTGTGGGGGGGTGGGGG - Intronic
909924852 1:81427163-81427185 GGAAACTTTCGAGGTGGTGGAGG + Intronic
910753432 1:90659482-90659504 GCTACTTTGGGAGGTTGTGGTGG - Intergenic
911648217 1:100357929-100357951 TCAACCTTCTGAGATGCTGGTGG + Intronic
912884047 1:113450313-113450335 GGAAACTTTGGAGGTGGTGGAGG + Intronic
917227059 1:172795515-172795537 GCCAGCTTCTGAGTTGGTGGTGG + Intergenic
917970235 1:180201480-180201502 GCACCTTTCAGAGGTGGTGGAGG - Exonic
919133731 1:193482817-193482839 GAAACATTGTGTGGTGGGGGTGG + Intergenic
919914470 1:202130965-202130987 GCAGGCTTGGGAGGTGGCGGTGG - Exonic
919993515 1:202726577-202726599 GCAGCTTTGTGAGGTGGGAGAGG - Exonic
920033616 1:203051751-203051773 GCGACCTTGAGCGGTGATGGGGG - Exonic
920806485 1:209239168-209239190 GAATCCATGTGAGGTGGTGGGGG - Intergenic
922177716 1:223209615-223209637 GCAACTAAGTGGGGTGGTGGGGG - Intergenic
922643594 1:227261843-227261865 GCAACCTAGGGTGTTGGTGGGGG + Intronic
922814048 1:228436656-228436678 GTCACATTGTGAGGTGATGGGGG + Intergenic
923740638 1:236651762-236651784 GCAACCTGGAGAGGTTGAGGAGG - Intergenic
923829941 1:237543686-237543708 GTAAGCTTGGGAGGTGGGGGTGG + Intronic
924801180 1:247330776-247330798 CCCACCTTGTGAGCTGTTGGAGG - Intronic
1063390361 10:5646228-5646250 GCCACCTGGTAATGTGGTGGGGG + Intronic
1063648473 10:7909312-7909334 GCACCCTAGTCAGGAGGTGGAGG + Intronic
1064907405 10:20361457-20361479 ATAACCCTGTGAGGAGGTGGGGG - Intergenic
1065625686 10:27626306-27626328 GCACCCTCCTGATGTGGTGGTGG + Intergenic
1065687675 10:28302671-28302693 GGCACCTTGTGAGGAGGTGGGGG - Intronic
1066686409 10:37985909-37985931 GCAACCTTGGGAGGCTGAGGTGG + Intergenic
1067156887 10:43789684-43789706 GGAAACTTTGGAGGTGGTGGAGG - Intergenic
1067615372 10:47756679-47756701 CCATCCCAGTGAGGTGGTGGTGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069269941 10:66513934-66513956 GCAACCTTCTGGGATGGTGTCGG + Intronic
1069615700 10:69804888-69804910 GCAACATTGTCTGATGGTGGTGG + Intronic
1069680349 10:70280340-70280362 GAACCCTTGTGTGGTGTTGGTGG - Intronic
1069943392 10:71970257-71970279 CCATCTTTGTGAGGAGGTGGTGG - Intronic
1071630774 10:87216630-87216652 CCATCCCAGTGAGGTGGTGGTGG - Intergenic
1071923220 10:90374965-90374987 GAAACAGTGTGGGGTGGTGGTGG - Intergenic
1075785829 10:125049492-125049514 GCAAGCTTGTGAGGTATTCGTGG - Intronic
1076198516 10:128539417-128539439 GAAAACCTGAGAGGTGGTGGAGG - Intergenic
1076723445 10:132402705-132402727 GCAACCCTGGGCGGGGGTGGGGG + Intronic
1077182750 11:1223917-1223939 CCAAGCTTGGGAGGGGGTGGAGG - Intronic
1077391332 11:2301923-2301945 GCACCAGGGTGAGGTGGTGGGGG + Intronic
1078039642 11:7847990-7848012 TCAACCGTGTGTGGGGGTGGAGG - Intergenic
1078050116 11:7957631-7957653 GAAACTTTGTGAGGGGGTGGTGG - Intergenic
1078239530 11:9518301-9518323 CCAACATTTGGAGGTGGTGGTGG - Intronic
1079105886 11:17572197-17572219 GCAAGCCGGTGAGTTGGTGGGGG + Exonic
1079737314 11:24013085-24013107 ACAACCTCCTGAGGTGGTGCAGG - Intergenic
1080540364 11:33258208-33258230 GCAACCTTGGCAGGGGGAGGGGG - Intronic
1080866587 11:36200614-36200636 GCAACATGGTGATGGGGTGGGGG + Intronic
1083103966 11:60339194-60339216 TCATCCTTGTGAGTTGGTGTTGG + Intronic
1084065927 11:66704549-66704571 CCAGCCTTGGGAGGTGGGGGTGG - Intronic
1084377456 11:68787551-68787573 GCCACATTCTGAGGTGCTGGGGG - Intronic
1087864140 11:103202612-103202634 ACAAGCTTGTGGGGTGGGGGTGG + Intronic
1090452072 11:126815434-126815456 GCTATTTTGTGAGGTTGTGGAGG + Intronic
1091112519 11:132983122-132983144 GCAACCTTGCAAGCTGGAGGGGG - Intronic
1091747842 12:3003915-3003937 GCACCCAGCTGAGGTGGTGGCGG - Intronic
1091919601 12:4293851-4293873 GGAACCTTGTGAAGTGTTGCTGG + Intronic
1092112045 12:5970825-5970847 GCAGCCTTGGGAGCTGGTGCTGG - Intronic
1096448090 12:51712903-51712925 GGAAGCTTTGGAGGTGGTGGAGG - Intronic
1097615847 12:61882900-61882922 ACAACCTTGTGAGGTAGTTAAGG - Intronic
1099051773 12:77789560-77789582 GCAACTTTGGGAGGCGGAGGCGG + Intergenic
1100441932 12:94625214-94625236 GTAATGTTGTGAGGTAGTGGTGG + Intronic
1100442723 12:94631323-94631345 GTTACATTGTGAGGTAGTGGGGG - Intronic
1101587905 12:106101142-106101164 GCAACCTGGGGGCGTGGTGGGGG - Intronic
1103525787 12:121567300-121567322 GCTACATTCTGAGGTGCTGGGGG - Intronic
1103987509 12:124777798-124777820 GGGACCCTGTGAGGGGGTGGGGG + Exonic
1104850097 12:131868640-131868662 CCAGCCTTCTGAGGTGGGGGCGG - Intergenic
1105243604 13:18628659-18628681 GGAGCCTGGTGAGATGGTGGAGG + Intergenic
1105264617 13:18804992-18805014 GAAACATTGGGAGGTGGGGGTGG - Intergenic
1105594423 13:21823325-21823347 GCCATCTTTTGGGGTGGTGGGGG - Intergenic
1106047785 13:26160997-26161019 GCCACATTGTGAGGTACTGGGGG + Intronic
1108431728 13:50360273-50360295 GCAGCCTTGGGACGTGCTGGAGG + Intronic
1109887470 13:68560708-68560730 GCCACCTCATGAGGTGGTTGTGG + Intergenic
1112526532 13:100153239-100153261 GTAACCTTATGATCTGGTGGAGG + Intronic
1112824705 13:103378774-103378796 GCAACCTTGTGGGTCGGTGGGGG + Intergenic
1113334815 13:109367654-109367676 GCCACATTCTGAGGTCGTGGGGG - Intergenic
1115191886 14:30755127-30755149 CCTACCTTGTGGGGTGGTTGTGG - Intergenic
1115475047 14:33805434-33805456 GCAGCCTTGTGAGCTGGAGGTGG + Intergenic
1115734631 14:36311383-36311405 GTACCCTTTTGAGATGGTGGTGG - Intronic
1116441773 14:44962399-44962421 GCAGGGTTGTCAGGTGGTGGTGG - Exonic
1118417378 14:65556370-65556392 ACAACCTTGTGAGGTGCTTGTGG + Intronic
1119113520 14:71997071-71997093 GCAATCTTGAGAGATGGTGGTGG + Intronic
1120262410 14:82202786-82202808 GCAACTATGTGAGGTGATGGAGG + Intergenic
1121013372 14:90534575-90534597 TCGGCCTTGAGAGGTGGTGGGGG + Exonic
1122065751 14:99173373-99173395 GAAACCTTGAGTGGTGGTGCTGG - Exonic
1122388254 14:101363294-101363316 GGAACCTTGTGTGCTGTTGGTGG - Intergenic
1123487697 15:20755973-20755995 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1123544189 15:21325031-21325053 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1125581756 15:40790695-40790717 GCAAGCCTGTGAGGTGGTCAAGG - Intronic
1128157481 15:65401021-65401043 GTAACCTGGTGAGGTGGTACCGG + Intronic
1128296171 15:66521739-66521761 GCCACTTTGGGAGGTGGAGGTGG - Intronic
1129597170 15:76974099-76974121 GCAACCTAGAGTGGAGGTGGAGG + Intergenic
1129951131 15:79592551-79592573 GAAACCTTGTGGGGTGATGGTGG - Intergenic
1130111458 15:80968876-80968898 CCAACCTTGTGGGGTTGTGAAGG + Intronic
1132058353 15:98669697-98669719 GCAGCCTTGTCAGGTGGGTGTGG + Intronic
1132330930 15:101012335-101012357 GCAGCTGTGTCAGGTGGTGGTGG + Intronic
1202952532 15_KI270727v1_random:52302-52324 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1133257091 16:4523712-4523734 GCAAACCTGGGAGGAGGTGGCGG + Intronic
1134231250 16:12432312-12432334 GAAACCTTGTGGTGTGGTGGAGG + Intronic
1135520415 16:23172692-23172714 GCTGCCTTGTGAGCTGGAGGGGG - Intergenic
1137583612 16:49650550-49650572 GCAACTCTGTGCAGTGGTGGTGG + Intronic
1137753215 16:50881820-50881842 GCCACCTTCTGAGGTCCTGGGGG + Intergenic
1138383559 16:56620349-56620371 GTATCCTTGTGAGGTTGTCGTGG - Intergenic
1140252923 16:73310240-73310262 AAAACCATCTGAGGTGGTGGTGG + Intergenic
1142287868 16:89178799-89178821 GCAGCCTGGAGAGGTGGAGGGGG + Intronic
1144622851 17:16829573-16829595 GCAACCCTGTGAGGTGGGTGTGG - Intergenic
1144883580 17:18443143-18443165 GCAACCCTGTGAGGTGGGTGTGG + Intergenic
1145148648 17:20501243-20501265 GCAACCCTGTGAGGTGGGTGTGG - Intergenic
1147521777 17:41180200-41180222 GTAACTATGTGAAGTGGTGGAGG - Intergenic
1147577175 17:41609509-41609531 GCAACCCTGTGAGGTGGGTATGG - Intergenic
1147680252 17:42238806-42238828 GAACTCTTGGGAGGTGGTGGTGG + Intronic
1148238061 17:45982655-45982677 GCCACCTAGCGAGCTGGTGGCGG + Intronic
1149473602 17:56940219-56940241 GCCACCTTTGGGGGTGGTGGGGG - Intronic
1151484142 17:74387976-74387998 GCCACCTACTGAGGTGGGGGCGG - Intergenic
1151946074 17:77320646-77320668 GAAACCTTGGGAGGGTGTGGGGG + Intronic
1152240377 17:79157719-79157741 CCAGCCTTAAGAGGTGGTGGTGG - Intronic
1152484792 17:80583524-80583546 GGGACCTTGTGAGCTGGTGGAGG + Intronic
1152486798 17:80599791-80599813 GGCCCCTTGTTAGGTGGTGGTGG + Intronic
1153352039 18:4092128-4092150 GCTACCTTGTGTGTAGGTGGGGG + Intronic
1154423773 18:14256568-14256590 GAAACATTGGGAGGTGGGGGTGG + Intergenic
1154445340 18:14431226-14431248 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1154485071 18:14866666-14866688 GCCCGCTTGTGGGGTGGTGGTGG + Intergenic
1155966999 18:32045410-32045432 TTAACCTGGTGTGGTGGTGGGGG + Intronic
1158220546 18:55146266-55146288 CCAACCTGGGGAGGAGGTGGGGG - Intergenic
1158438922 18:57456115-57456137 GGAACCTTGTGTGCTGTTGGTGG + Intronic
1158439015 18:57457146-57457168 GGAACCTTGTGTGCTGTTGGTGG - Intronic
1158514921 18:58123111-58123133 GGAACATTCAGAGGTGGTGGAGG - Intronic
1158946407 18:62450855-62450877 GCAACAGTTGGAGGTGGTGGTGG - Intergenic
1160683749 19:424039-424061 GCTGCTTTGTCAGGTGGTGGAGG + Intronic
1161801317 19:6418058-6418080 GCAAGCCTGTGAGATGGTGATGG - Exonic
1161921248 19:7267855-7267877 GCAACCTAGTGAGGTTGTTCCGG + Exonic
1162020658 19:7867010-7867032 GCACCCCTGGGAGGTGGAGGAGG - Intergenic
1162046797 19:8005480-8005502 GCATCCAGGTGAGGCGGTGGGGG - Exonic
1162218368 19:9155746-9155768 GCAATGTGGTGATGTGGTGGGGG - Intronic
1162311735 19:9912308-9912330 GCAAGGGTGTGTGGTGGTGGTGG - Intronic
1163496637 19:17649725-17649747 GTCACCTTCTGAGGTAGTGGGGG - Intronic
1163520797 19:17790520-17790542 GCTACATTATGAGGAGGTGGTGG - Intergenic
1163702063 19:18790982-18791004 GCAACGGTGGGAGTTGGTGGTGG - Intronic
1165225647 19:34352866-34352888 GCTGCCTTGTGTGCTGGTGGGGG - Exonic
1165579394 19:36849314-36849336 GAAACTTTGGGAGGTGGTAGAGG - Intronic
1166525042 19:43505200-43505222 GCAAAGTTGTGGGGGGGTGGCGG - Intergenic
1166654152 19:44597993-44598015 GAAACCTTGTGTGCTGTTGGTGG + Intergenic
1166870060 19:45865481-45865503 TCAACGTTGTGAGGTTGTTGGGG + Intronic
1167261768 19:48462802-48462824 GCAGCTTTGCGAGGGGGTGGTGG + Intronic
925075846 2:1014937-1014959 GCAGCCTTGAGGGGTGGAGGGGG + Intronic
926532652 2:14069790-14069812 GCAGCCTCGAGAGGAGGTGGTGG - Intergenic
926984959 2:18612532-18612554 GTCACATTGTGAGGTAGTGGGGG + Intergenic
927662439 2:25004222-25004244 GCCACCTTGTTAGGTAGAGGAGG + Intergenic
927974275 2:27326450-27326472 GGAGCCTTGAGAGTTGGTGGAGG + Exonic
928208991 2:29309725-29309747 GCAACCGTGGGGGGTGGGGGTGG + Intronic
929902908 2:46021221-46021243 ACAACCTTGTGAGGAGGTACTGG + Intronic
932012155 2:67989292-67989314 GCAAACTTGGGAGTGGGTGGGGG + Intergenic
932817333 2:74872488-74872510 GCCACCTGCTGTGGTGGTGGTGG + Intronic
936344559 2:111665347-111665369 GAAACACTGTGAGGTGGGGGTGG - Intergenic
938426640 2:131196697-131196719 GAAACATGGTGAGGTTGTGGAGG - Intronic
941344633 2:164352357-164352379 GTCACATTGTGAGGTGCTGGGGG + Intergenic
943674953 2:190707380-190707402 GCAGCCTTGTGAGGAGCTGATGG + Intergenic
945291916 2:208135311-208135333 GCAGCCTTCTGAAGTGGAGGGGG - Intergenic
945658827 2:212659340-212659362 GCATTCTTGTGGGGTGGTGGGGG + Intergenic
946307711 2:218865627-218865649 TCATTCTTGTGAGGAGGTGGGGG + Intronic
947545781 2:231009278-231009300 TCATTCTGGTGAGGTGGTGGTGG - Intronic
948183446 2:236001016-236001038 GCCACATTCTGAGGTAGTGGGGG - Intronic
1169842538 20:9955766-9955788 GTGAAGTTGTGAGGTGGTGGGGG - Intergenic
1169940229 20:10928930-10928952 GGTAACTTGGGAGGTGGTGGAGG - Intergenic
1170217860 20:13910334-13910356 GCAACCTTGTGAAGTAATGTGGG + Intronic
1170779930 20:19416159-19416181 CCACCTTGGTGAGGTGGTGGGGG - Intronic
1171492722 20:25532532-25532554 GCAGCCTTGAGAAGTGGTGGGGG - Intronic
1172110415 20:32541482-32541504 GCCACCTTGGATGGTGGTGGGGG + Intronic
1173800962 20:45894233-45894255 GCCACCATAGGAGGTGGTGGTGG - Intronic
1174567715 20:51478782-51478804 GGAGCCTAGTGGGGTGGTGGAGG - Intronic
1174736518 20:52971098-52971120 GGCACCTTTTGAGGTGTTGGGGG - Intergenic
1175195658 20:57241626-57241648 GCCTCCTTGTTAGGTGCTGGGGG + Intronic
1175722144 20:61293941-61293963 GGAAGCTGGTGAGGTGCTGGGGG + Intronic
1176450646 21:6858636-6858658 GGAGCCTGGTGAGATGGTGGAGG + Intergenic
1176796256 21:13372809-13372831 GCCCACTTGTGGGGTGGTGGGGG - Intergenic
1176828816 21:13723654-13723676 GGAGCCTGGTGAGATGGTGGAGG + Intergenic
1176849695 21:13903440-13903462 GAAACATTGGGAGGTGGGGGTGG - Intergenic
1177781052 21:25622677-25622699 GCAGCTTTCTGGGGTGGTGGGGG + Intergenic
1178383294 21:32129485-32129507 GCAACTTTGTGAGGTGGGCATGG + Intergenic
1178419698 21:32433754-32433776 GCCACATTTTGAGGTGCTGGGGG - Intronic
1179608945 21:42536633-42536655 GCCACATTGTAATGTGGTGGAGG + Intronic
1180076379 21:45465396-45465418 GCAGCCTTGGGATTTGGTGGAGG + Intronic
1180931903 22:19598052-19598074 GCACCCCTGGGTGGTGGTGGGGG + Intergenic
1182320264 22:29474239-29474261 GCCACAGAGTGAGGTGGTGGAGG - Intergenic
1182425127 22:30267651-30267673 GCAACCCTGTGAGGTGGGCTGGG - Intergenic
1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG + Intronic
1182866738 22:33610839-33610861 GCAGCCTTTTGGGGTGGTGCAGG - Intronic
1183590550 22:38777061-38777083 TCAACCTCGTGAGGTGGGTGCGG + Intronic
1183829444 22:40409988-40410010 AAAACCTTGTGAGGAGGTGGGGG + Exonic
1184318561 22:43720032-43720054 GTATCCATGTGAGGTGATGGAGG + Intronic
1184387815 22:44186290-44186312 GAGAACTGGTGAGGTGGTGGTGG + Intronic
1185136584 22:49076829-49076851 GAAGCCTTGGGAGGTGGTGCTGG + Intergenic
949929072 3:9064275-9064297 GCATCCCAGTGGGGTGGTGGTGG - Intronic
951909291 3:27732047-27732069 GCAAACTTATGGGTTGGTGGAGG + Intergenic
952071134 3:29637345-29637367 GCATCTTTCGGAGGTGGTGGTGG - Intronic
952210707 3:31226598-31226620 GCCACCCAGTGAAGTGGTGGGGG + Intergenic
953248682 3:41222429-41222451 GCAACCCTATGAGGTGAAGGAGG - Intronic
953369683 3:42376721-42376743 GCACCCTGTTGAGGTGGTTGAGG - Intergenic
954105313 3:48406698-48406720 GCAGCCCTGTGAGCTGGTTGGGG - Intronic
955138869 3:56249180-56249202 GCATCCTTGTAAGGTTGAGGTGG - Intronic
955783220 3:62508211-62508233 GCAGCCTGGTGGGGTGGTGATGG + Intronic
955889100 3:63631713-63631735 TCAACCATGTGAAGTGCTGGGGG - Intergenic
956287376 3:67625325-67625347 GCAAACTTGTAAGGTCATGGTGG - Intronic
957590955 3:82197087-82197109 GTAACATTCTGAGGTGATGGGGG + Intergenic
958974294 3:100648859-100648881 GAAATCTGGTGAGGTAGTGGTGG - Intronic
959357410 3:105350153-105350175 GCAACCTTGTCACGTTGTTGGGG - Intergenic
959713929 3:109412575-109412597 GTTACCTTGTGAGGTACTGGGGG + Intergenic
961327910 3:126120968-126120990 GCCACATTGTGAGGTACTGGGGG - Intronic
962343110 3:134601758-134601780 GCACCCTTGTGAGCTGGTTCTGG + Intronic
962352717 3:134667367-134667389 GGAATGCTGTGAGGTGGTGGCGG + Intronic
962411308 3:135143775-135143797 GCAACCATGGGAGGCTGTGGAGG - Intronic
964023405 3:152042089-152042111 GCAAGCCTGTGGGGTGGAGGGGG - Intergenic
965663113 3:171063307-171063329 GCAACCTTTTGGGTTGGTGAAGG + Exonic
966229360 3:177634357-177634379 GAAACATTGTTAGGTGGTGCAGG + Intergenic
967047987 3:185755195-185755217 GCAGCCTCCTGAGGTGGTGCAGG - Intronic
968089524 3:195891742-195891764 GGATCCTTGGGAGTTGGTGGTGG - Intronic
968819353 4:2837877-2837899 ACACACTTCTGAGGTGGTGGGGG - Exonic
968892690 4:3379395-3379417 GCAACTAAGTGAGGTGGTGGAGG + Intronic
969326937 4:6449582-6449604 GCAACCACGTGAGGATGTGGGGG - Intronic
971246814 4:24936862-24936884 GCAAGCTTTTGTGGTGTTGGAGG + Intronic
973898313 4:55439393-55439415 GAAACCTTGTGCAGTGCTGGTGG + Intronic
974605622 4:64146475-64146497 TCAACATTGTCAGGTGGGGGAGG + Intergenic
974908148 4:68082512-68082534 GCATCCTTGGGAGGGGCTGGTGG - Intronic
980812795 4:137904600-137904622 GCACCCTTGTGAGGATTTGGGGG - Intergenic
980858096 4:138464528-138464550 GCACACTTGGGAGGCGGTGGGGG + Intergenic
983076520 4:163332695-163332717 GCACCTTTGTGAGGTGTTTGTGG - Exonic
984804605 4:183739730-183739752 GGAACTGTGTGAGGTGGCGGGGG - Intergenic
986216052 5:5720117-5720139 GTAACATTCTGAGGTAGTGGGGG + Intergenic
988536513 5:32073822-32073844 GGCTCCTTGTGAGCTGGTGGAGG - Exonic
988997766 5:36730717-36730739 GCCTCCTTCTGGGGTGGTGGTGG - Intergenic
989425370 5:41290429-41290451 GCAACATGGTGAGGTGGAGTGGG + Intergenic
991268480 5:64750479-64750501 ACTACTCTGTGAGGTGGTGGGGG - Intronic
992581477 5:78182813-78182835 ACCACCTAGTGAGGTGGTTGGGG - Intronic
992772852 5:80064617-80064639 GCAACCTTGGGAGGTTGAGGTGG + Intronic
994697125 5:103086330-103086352 GTCACATTTTGAGGTGGTGGGGG + Exonic
997445975 5:133940666-133940688 GCATCCTTGGCAGGGGGTGGGGG - Intergenic
1000037608 5:157460638-157460660 GACACCCTGAGAGGTGGTGGGGG + Intronic
1000746079 5:165035681-165035703 GCAAACTTTGGTGGTGGTGGTGG - Intergenic
1001086106 5:168701080-168701102 GCAACCCTGTGAGGTGGACTTGG - Intronic
1002577977 5:180187877-180187899 GAAACCTTGTGTGTTGCTGGTGG + Intronic
1002711670 5:181198643-181198665 GCCACATAGTGCGGTGGTGGTGG - Intronic
1002940427 6:1710838-1710860 GCACCCCTGTGAGTTTGTGGAGG + Intronic
1003765923 6:9236515-9236537 GCTACTTTGTGAGGTGGCAGAGG + Intergenic
1004043773 6:12008363-12008385 ACAAACTTGTAAGATGGTGGTGG - Intergenic
1004905852 6:20236257-20236279 GCAGACTTGGAAGGTGGTGGGGG + Intergenic
1005240959 6:23825693-23825715 GCACCCTTGCTTGGTGGTGGTGG - Intergenic
1005904225 6:30247177-30247199 GTAACTATGTGAGGTGATGGAGG - Intergenic
1006444436 6:34070856-34070878 GAAACTTTGTGAGCTTGTGGTGG - Intronic
1006698846 6:35955340-35955362 GCAACAGTATGAGGAGGTGGAGG - Exonic
1007475078 6:42114257-42114279 GCATGGTGGTGAGGTGGTGGGGG - Intronic
1009907272 6:69885184-69885206 GCAACTTACAGAGGTGGTGGGGG - Intronic
1010058672 6:71595682-71595704 GCAACCTCATGAGTTGCTGGTGG - Intergenic
1010167792 6:72938025-72938047 ACAACCTTGTAAGGTGGTCAGGG - Intronic
1010492830 6:76495041-76495063 TCAACATTGTCAGGTGGGGGAGG + Intergenic
1010512642 6:76739499-76739521 GAAACCTTGTAAGCTGTTGGTGG + Intergenic
1010772385 6:79846182-79846204 GCAACCTTGTGTGGTGAGGCTGG - Intergenic
1011213415 6:84978654-84978676 GCAATGTTGTGAGGTTGGGGAGG + Intergenic
1013770106 6:113619283-113619305 GCAACGTTATGGTGTGGTGGGGG - Intergenic
1015551948 6:134420805-134420827 GGAATCATGGGAGGTGGTGGTGG - Intergenic
1016032703 6:139354467-139354489 GGTCCCTTGTGAGGTGGAGGTGG - Intergenic
1016212927 6:141562320-141562342 GCAGCCTGGTGAGGAGGTGGAGG - Intergenic
1017533118 6:155316853-155316875 GCAACCTTATGAAGAGCTGGAGG - Intergenic
1018622711 6:165747337-165747359 CAAACCTTGTGAGCCGGTGGAGG - Intronic
1018899349 6:168043432-168043454 GCCACCCTGGGAGGTGGTGGAGG + Intronic
1020272343 7:6604752-6604774 GCATCCTTGTGTGGGGGTTGGGG + Intronic
1022945928 7:35283690-35283712 GCCACATTGTGAGGTACTGGGGG - Intergenic
1023047148 7:36220055-36220077 GCTACCAGGTGAGGTCGTGGAGG + Intronic
1023878451 7:44305606-44305628 GCACCCCTGTGAGGTGGGGGAGG + Intronic
1024313878 7:47995221-47995243 GAAAGATGGTGAGGTGGTGGTGG + Intronic
1024914620 7:54485302-54485324 TCACCCTTGGGAGGAGGTGGGGG - Intergenic
1028358707 7:89940859-89940881 GAAACTTTTTGAGGTGATGGAGG + Intergenic
1030184577 7:106748875-106748897 GCAACCCTGTGAATTGTTGGTGG + Intergenic
1032400127 7:131619028-131619050 GCAACCTTAAGAGGTGGAGAGGG - Intergenic
1033227822 7:139575021-139575043 GCAGCCCTGTGAGGTGGGTGAGG + Intronic
1034944081 7:155250750-155250772 GTCACCTTCTGAGGTGCTGGAGG - Intergenic
1035044505 7:155954793-155954815 GCAGCCCTGTCAGGAGGTGGAGG - Intergenic
1040978097 8:53216077-53216099 GCCACATTCTGAGGTGCTGGGGG + Intergenic
1041373637 8:57190742-57190764 GCAAGCGTGTGAGCTGGTGGGGG + Intergenic
1041532703 8:58889483-58889505 GCTACCTCTTGTGGTGGTGGGGG + Intronic
1041933819 8:63315136-63315158 GTAACATTGTGAGGTGGAGGTGG - Intergenic
1042826597 8:72986031-72986053 GCAGCCTGGTGTGGTGGTGGGGG + Intergenic
1044603917 8:94032640-94032662 GCAACATTGAGGGGCGGTGGGGG + Intergenic
1044866428 8:96575349-96575371 GCAAACCTGCGGGGTGGTGGGGG + Intronic
1046363300 8:113190251-113190273 GTAAACTTGTGAGCAGGTGGTGG + Intronic
1047401992 8:124555886-124555908 GCAGCCTGGTGAGGAGATGGAGG - Exonic
1049432675 8:142572477-142572499 TCAGCCTTGTGAGCTGGTGGTGG - Intergenic
1050916152 9:11136202-11136224 GCAAACATGTGAAGTGGTGCAGG - Intergenic
1053786166 9:41654398-41654420 GCACACTTGTGAGATGGCGGAGG + Intergenic
1053885995 9:42645525-42645547 GCCCGCTTGTGGGGTGGTGGGGG + Intergenic
1054174882 9:61868343-61868365 GCACACTTGTGAGATGGCGGAGG + Intergenic
1054225015 9:62452974-62452996 GCCCGCTTGTGGGGTGGTGGGGG + Intergenic
1054662657 9:67712450-67712472 GCACACTTGTGAGATGGCGGAGG - Intergenic
1054754796 9:68946749-68946771 ACCACCATCTGAGGTGGTGGGGG - Intronic
1055115981 9:72606021-72606043 TCCACATTCTGAGGTGGTGGGGG + Intronic
1056382942 9:86071584-86071606 GAAACGCTGTGAGGTGGAGGTGG + Intronic
1056690776 9:88807038-88807060 GCACCATTTTGAGATGGTGGAGG + Intergenic
1058990352 9:110249798-110249820 GCAACCTTGGGAGGTTGATGGGG + Intronic
1059592375 9:115675666-115675688 GTTACCAGGTGAGGTGGTGGGGG - Intergenic
1059868702 9:118546360-118546382 GCATGCTTGTGAGTTGGTGTGGG - Intergenic
1060931453 9:127491861-127491883 GCAACTTTGGCAGGTGGGGGAGG + Intronic
1060941261 9:127544363-127544385 GCAACCTTGTGAGGTGGTGGTGG - Intronic
1061432866 9:130542426-130542448 ACAAACTTGTGAGGTGGGGTGGG + Intergenic
1203518536 Un_GL000213v1:25881-25903 GGAGCCTGGTGAGATGGTGGAGG - Intergenic
1185927345 X:4162028-4162050 GCAACTTTGTGAGTTAGTTGAGG + Intergenic
1188729697 X:33631268-33631290 GCACCCTTGGGTGCTGGTGGAGG - Intergenic
1189356196 X:40311630-40311652 GCACAGTTGTGAGGTGGTGGTGG + Intergenic
1189721182 X:43920241-43920263 GCTACATTGTGAGGTATTGGGGG - Intergenic
1191008889 X:55740073-55740095 GCAACTTTGGGAGGCCGTGGCGG + Intronic
1191586683 X:62834430-62834452 GCAGCCTGGTGATGTGGTAGAGG - Intergenic
1192218216 X:69178686-69178708 GTAACATTGTGAGGTGGGGGTGG + Intergenic
1192300479 X:69896289-69896311 GCCACATTGTGAGGTACTGGGGG + Intronic
1192722697 X:73716401-73716423 GCTGTCTTGGGAGGTGGTGGGGG - Intergenic
1194268620 X:91782577-91782599 ACAAAATTGTGAGGTGGGGGAGG + Intronic
1195087732 X:101428404-101428426 GGAATCTTATGAGGTGATGGAGG + Intronic
1195225198 X:102785265-102785287 GCACCCTTGTCAGGGGGTGTTGG + Intergenic
1197280689 X:124532121-124532143 GCCACCTTGTTAACTGGTGGAGG - Intronic
1197584491 X:128328285-128328307 GCAACTTTGGGAGGCGGAGGCGG - Intergenic
1200585820 Y:5003492-5003514 ACAAAATTGTGAGGTGGGGGAGG + Intronic
1201796435 Y:17901666-17901688 GCAACCTGCTGAGGTGCTTGAGG - Intergenic
1201805120 Y:18004319-18004341 GCAACCTGCTGAGGTGCTTGAGG + Intergenic
1202357819 Y:24070730-24070752 GCAACCTGCTGAGGTGCTTGAGG - Intergenic
1202512959 Y:25599383-25599405 GCAACCTGCTGAGGTGCTTGAGG + Intergenic