ID: 1060942154

View in Genome Browser
Species Human (GRCh38)
Location 9:127548984-127549006
Sequence GTGTGTAAGCAGAGGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060942146_1060942154 10 Left 1060942146 9:127548951-127548973 CCCTGGCGGGTAGGGAAGGCCTC 0: 1
1: 0
2: 1
3: 18
4: 163
Right 1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG No data
1060942141_1060942154 23 Left 1060942141 9:127548938-127548960 CCAGGATAAGGGACCCTGGCGGG 0: 1
1: 0
2: 0
3: 14
4: 104
Right 1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG No data
1060942150_1060942154 -9 Left 1060942150 9:127548970-127548992 CCTCATCACTGGAGGTGTGTAAG 0: 1
1: 4
2: 11
3: 57
4: 226
Right 1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG No data
1060942139_1060942154 24 Left 1060942139 9:127548937-127548959 CCCAGGATAAGGGACCCTGGCGG 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG No data
1060942147_1060942154 9 Left 1060942147 9:127548952-127548974 CCTGGCGGGTAGGGAAGGCCTCA 0: 1
1: 0
2: 0
3: 17
4: 164
Right 1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060942154 Original CRISPR GTGTGTAAGCAGAGGCTGGA GGG Intronic
No off target data available for this crispr