ID: 1060944490

View in Genome Browser
Species Human (GRCh38)
Location 9:127561916-127561938
Sequence CTTCTGTGCTGGAGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 379}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060944490_1060944502 -4 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944502 9:127561935-127561957 GAAGTGGATGGGGTGGGGCAGGG No data
1060944490_1060944499 -10 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944499 9:127561929-127561951 AGCACAGAAGTGGATGGGGTGGG No data
1060944490_1060944503 -3 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944503 9:127561936-127561958 AAGTGGATGGGGTGGGGCAGGGG No data
1060944490_1060944505 16 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944505 9:127561955-127561977 GGGGAAGGAAAAAGCAGTGCAGG No data
1060944490_1060944501 -5 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944501 9:127561934-127561956 AGAAGTGGATGGGGTGGGGCAGG No data
1060944490_1060944504 1 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944504 9:127561940-127561962 GGATGGGGTGGGGCAGGGGAAGG No data
1060944490_1060944500 -9 Left 1060944490 9:127561916-127561938 CCCTTCTTCCTCCAGCACAGAAG 0: 1
1: 0
2: 4
3: 51
4: 379
Right 1060944500 9:127561930-127561952 GCACAGAAGTGGATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060944490 Original CRISPR CTTCTGTGCTGGAGGAAGAA GGG (reversed) Intronic
900106848 1:985364-985386 TTTCTGTCCTGTACGAAGAAGGG - Intergenic
900803921 1:4755100-4755122 CTCCTGTCCTGGTGGGAGAAGGG + Intronic
900808281 1:4782083-4782105 CTCCTGTGCTGCGGGAAGAATGG - Intronic
904787013 1:32990822-32990844 CATCTGCCTTGGAGGAAGAAGGG - Intergenic
904838586 1:33355451-33355473 CTCCTTTGCTGGAGGAACACTGG + Intronic
905134350 1:35787018-35787040 CTCCTGTGAAGGAGGAACAACGG + Intergenic
905450235 1:38051463-38051485 TTTCAGTGCTGGGGGAAGACAGG + Intergenic
907386120 1:54126316-54126338 CCTCAGTGCTGGTGGAAGCAAGG - Intergenic
909022123 1:70443979-70444001 TGTCTGTGCTGGACTAAGAATGG - Intergenic
909184139 1:72463777-72463799 TTGCATTGCTGGAGGAAGAAAGG + Intergenic
909286992 1:73832064-73832086 TTTCTGTGCTGGGGTAAGAATGG - Intergenic
910665784 1:89724874-89724896 CTTCTGTGCTGGGATAAAAATGG - Intronic
914814469 1:151053285-151053307 CTTCTGGGCTGGAAACAGAATGG + Exonic
915449678 1:155995931-155995953 GGTCTGAGCTGGAGGAAGAAGGG - Intronic
916186636 1:162139454-162139476 TCTCAGTGCTGGAGGAACAATGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917498229 1:175562222-175562244 CTTCAGTGCTGGAGAAAAAATGG - Intronic
917639532 1:176969497-176969519 TTTCTGGGCTGGAGCTAGAAAGG + Intronic
919056412 1:192575284-192575306 CTTCTTTTCTGCAGGAAGCAGGG - Intergenic
919992114 1:202715224-202715246 CTTCATTGCAGAAGGAAGAAGGG - Intergenic
920019960 1:202948267-202948289 CTTCTGTCCTGGAAGGGGAAGGG - Intronic
920303637 1:205004973-205004995 CTTCTGTGCTGGGGGCGGGATGG + Intronic
920422380 1:205843910-205843932 ATTTTATACTGGAGGAAGAATGG + Intronic
921187581 1:212683546-212683568 CTGCTGGGCTGAAGGAAGGAAGG - Intergenic
922413985 1:225403743-225403765 CTTCTTTGCTGGGGGAAGAAGGG - Intronic
923105699 1:230851679-230851701 CTTCTGTGATGGAAGAAGTCTGG + Intronic
923455724 1:234163511-234163533 GTTCAGTGATGGAGGGAGAAGGG + Intronic
1063161082 10:3419253-3419275 CTTGTGTGGTGGAAGGAGAATGG + Intergenic
1064372565 10:14765601-14765623 CTTCTGTGTTTGTGGAAGGAGGG + Intronic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1067452620 10:46391637-46391659 CTTCTGTGCTGCATGCAGAGGGG - Exonic
1067498593 10:46781588-46781610 CTTCTCTGCTGAAGGAGGAAAGG - Intergenic
1067584612 10:47468118-47468140 CTTCTGTGCTGCATGCAGAGGGG + Exonic
1067596053 10:47558817-47558839 CTTCTCTGCTGAAGGAGGAAAGG + Intergenic
1067793365 10:49303884-49303906 CTGCTGTGCTGGTTGGAGAAAGG + Intronic
1067797227 10:49329400-49329422 ATTCTGTGCTTCAGGAAGACAGG - Intergenic
1070056775 10:72942737-72942759 TTTCCTTGCAGGAGGAAGAAAGG + Exonic
1071453876 10:85826755-85826777 CTGCTGTGCTGGAGGAACTGAGG - Intronic
1071616952 10:87083549-87083571 CTTCTCTGCTGAAGGAGGAAAGG - Intronic
1072231160 10:93415078-93415100 CTTGTGGGCTGGAGTAAGAGAGG - Intronic
1073544676 10:104338206-104338228 CTAGTGTGCTGAAGGAAGAAGGG - Intronic
1073986517 10:109215807-109215829 TTTCTTTGCTGGAGAAAGCAGGG - Intergenic
1074082944 10:110182230-110182252 TGTCTGGGCAGGAGGAAGAAGGG - Intergenic
1074290346 10:112133510-112133532 CGTCTGTGCTGGGGGAAGAAGGG - Intergenic
1074393098 10:113074124-113074146 CGTCTGTGCTCCAGGAAGAAAGG - Intronic
1075096987 10:119478518-119478540 TTTCTGTGATGTAGGAAGAAAGG - Intergenic
1075904832 10:126072172-126072194 CAACTGTGCTGGGGGAAGATAGG - Intronic
1078169072 11:8914836-8914858 CATCTGTGCCAGAGGAAGGAGGG + Exonic
1078964383 11:16320957-16320979 CATCTTTCCTGGAGGAAGGAAGG - Intronic
1078974991 11:16463657-16463679 TTTCTGTGGTGGGGAAAGAATGG - Intronic
1079280478 11:19082856-19082878 CTAGTGTGCTGGGGAAAGAATGG - Intergenic
1079411277 11:20190158-20190180 GTCCTGTGGTGGAGGGAGAAGGG - Intergenic
1079413219 11:20208956-20208978 CTTTTGTGCTGAAATAAGAAGGG - Intergenic
1079991547 11:27251726-27251748 CTTTTGTACTGAAGGTAGAATGG - Intergenic
1082061230 11:47861923-47861945 CTGCTGTGCTGGGACAAGAATGG - Intergenic
1084533439 11:69742967-69742989 CTTCTGGGCTGGAGGGATACTGG - Intergenic
1084808365 11:71595957-71595979 CTTCTGTGTTTGAAGAAAAAAGG + Intronic
1084962866 11:72726525-72726547 CTTTGGTGCTGGGGTAAGAAAGG - Intronic
1085090502 11:73708733-73708755 TTTCTGTGTTGTAGGAAGCAGGG - Intronic
1085353663 11:75816433-75816455 CTTCTTGGCAGGAGGAATAAAGG - Intronic
1086019907 11:82215255-82215277 TCTCTGTGCTGGAGGGAGTATGG - Intergenic
1086437116 11:86792368-86792390 CATCTGGGCAGGAGGCAGAAAGG - Intronic
1088455324 11:110027296-110027318 CCTCTGTTCTAGAGGAAGTAGGG + Intergenic
1089088154 11:115841459-115841481 CACCTGTGCTGGAGGAAGGGAGG - Intergenic
1089352784 11:117830890-117830912 CTGCTGGGCTGGAGAAGGAAGGG - Intronic
1089638760 11:119833250-119833272 CATCTCTCCTGGAGGAAGGAGGG + Intergenic
1090228165 11:125083924-125083946 CTTGTGGGGTGCAGGAAGAAGGG + Intronic
1090919794 11:131197723-131197745 GTTCTGTGCTGGATGCTGAAGGG + Intergenic
1091107195 11:132933956-132933978 CTCCTGTGATGGAGAAAAAAAGG - Intronic
1091641752 12:2242358-2242380 CCTCCGTGCTGGAGGAACAATGG + Intronic
1092551177 12:9501640-9501662 ATTTTGTGCTTTAGGAAGAAGGG - Intergenic
1093859884 12:24152037-24152059 CTTCAGTGATAGAGGAAGACTGG - Intergenic
1093948069 12:25133533-25133555 CTTCTGTGCTGAAGGGGGAAGGG - Intronic
1094520630 12:31184716-31184738 ATTTTGTGCTTTAGGAAGAAGGG + Intergenic
1096606203 12:52768308-52768330 GTTCTGTGCTGGAGGGTGCACGG - Exonic
1096857027 12:54490771-54490793 CTTGAGTGCTGGAGAAAGAAAGG + Intergenic
1097429730 12:59490122-59490144 CTCCTGTGATAAAGGAAGAAAGG - Intergenic
1098206793 12:68119070-68119092 CTTGCCTGCTGGAGAAAGAAGGG + Intergenic
1100404786 12:94263563-94263585 GATCTGTGCTGGAGGAAAAGAGG + Intronic
1100949502 12:99830263-99830285 TTTCTGTGCTGTAGGAACTATGG - Intronic
1101015352 12:100494987-100495009 CTTCTGTGCTGGCTGAAAATTGG - Intronic
1101041588 12:100761182-100761204 CCTCAGTGGTGGAGGAAGGAAGG + Intronic
1102196242 12:111027148-111027170 GTTCTGTGCTGTTGGAAAAAAGG + Intergenic
1102975931 12:117207299-117207321 CAGCTGTGCTGGAGGAAAAGGGG + Intergenic
1103402167 12:120650504-120650526 CATCCGTCCTGGAGGAAGAACGG + Intronic
1105741642 13:23330922-23330944 CATCTGTGGTGGAGCAAGCATGG - Exonic
1105928018 13:25025356-25025378 CTTCTGTGGTCTAAGAAGAAAGG - Intergenic
1107157569 13:37187182-37187204 CTGCTTTGCTGGAGGAAGTATGG + Intergenic
1108360316 13:49663022-49663044 CTTCTGTCCTGCTGGAAGGAGGG - Intronic
1108451804 13:50574752-50574774 CTTCTCTGCCTGAGGAAGAAAGG - Intronic
1110315043 13:74096386-74096408 TTTCTGTGCTGGAGAGAGAGGGG - Intronic
1111285350 13:86084064-86084086 TGTCAGTGCTGGAGGAAGGAGGG + Intergenic
1112080951 13:95969654-95969676 CTTCTCTGCTTAAGCAAGAAAGG + Intronic
1113769774 13:112900620-112900642 CTTGTGTGTTGGGGGAAGAGGGG + Intronic
1114978744 14:28135041-28135063 CTTCTGTGCTAGACGAGGAAAGG - Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115515485 14:34180861-34180883 ATTCTGAGCTGGAGGAACAGAGG - Intronic
1118646481 14:67846000-67846022 CTTCTGTGCTGGAGGAGCCCAGG + Intronic
1119662148 14:76459801-76459823 GCTCTGTGCTGGAGGATGGAAGG - Intronic
1120370943 14:83634731-83634753 CTTCTGAGGAGGATGAAGAAGGG + Intergenic
1121054000 14:90838249-90838271 TTTCCATCCTGGAGGAAGAAAGG - Intergenic
1121066775 14:90974642-90974664 CTACTGTACTGGAGGATGAGAGG + Intronic
1121228900 14:92342010-92342032 CATATGTGTAGGAGGAAGAAAGG + Intronic
1121409478 14:93739583-93739605 ATTCTGTGCAGCATGAAGAAAGG + Intronic
1121879816 14:97489994-97490016 CTTCTGAGCTGGAGGCAGGCTGG + Intergenic
1121999450 14:98634828-98634850 GTTTGGTGCTGGAGAAAGAAGGG - Intergenic
1123048675 14:105530448-105530470 CTACGGTGCTGGGGGAAGATGGG - Intergenic
1123550213 15:21370443-21370465 CTCCTGTACTGGAGGAAGAGTGG + Intergenic
1124882682 15:33656853-33656875 TTTTCCTGCTGGAGGAAGAAGGG - Intronic
1126884392 15:53134095-53134117 AGGCTGAGCTGGAGGAAGAAAGG + Intergenic
1127269575 15:57388344-57388366 CCTTTGTGCTGGACGAAGACAGG + Intronic
1127272008 15:57409981-57410003 CTTCTGTTCTGGAAGATTAAAGG + Intronic
1128223929 15:65988764-65988786 TCTCTGGGCTGGAGGAAGACAGG + Intronic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1129264307 15:74385810-74385832 CTTCTGTGGGGGAGGGGGAAGGG - Intergenic
1130109730 15:80954372-80954394 CTTCAGTACTGGAGGCAGGAGGG - Intronic
1130709339 15:86264414-86264436 CTTCTGTGCAGGGTGAAGACGGG + Exonic
1130919430 15:88331756-88331778 CCTCTGTGCTGCAGCTAGAAGGG - Intergenic
1202958554 15_KI270727v1_random:97698-97720 CTCCTGTACTGGAGGAAGAGTGG + Intergenic
1132691378 16:1183274-1183296 CCTCTGTGCTGGGGGAAAACTGG - Intronic
1134180822 16:12046404-12046426 CTTTTGTGATGGATGAAGAAAGG + Exonic
1134295575 16:12942411-12942433 ATTCTGTGCAGTTGGAAGAAAGG - Intronic
1134612380 16:15619515-15619537 CTGAAGTGCTGGAGGAAGGAGGG - Intronic
1135307572 16:21380165-21380187 CTTTTGTGATGGATGAAGAGAGG + Intergenic
1135587174 16:23679899-23679921 CCGCTGTGCTGGAGAAGGAATGG + Intronic
1136020006 16:27434254-27434276 CTCGAGGGCTGGAGGAAGAATGG - Intronic
1136033990 16:27524772-27524794 TTTCTGTCCTGTTGGAAGAAAGG - Intronic
1136157021 16:28389858-28389880 CTTTTGTGCTGGATGGAGAAAGG - Intronic
1136206065 16:28725423-28725445 CTTTTGTGCTGGATGGAGAAAGG + Intronic
1136304316 16:29359285-29359307 CTTTTGTGATGGATGAAGAGAGG + Intergenic
1136747952 16:32608618-32608640 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1138647569 16:58436135-58436157 CTTCTCTGCTGGGGGGAGCAGGG - Intergenic
1138836577 16:60443972-60443994 CTTCTGTGCCCAAGGAAGAAAGG - Intergenic
1139325064 16:66146096-66146118 GGTCTGAGCTGGAGGAACAATGG + Intergenic
1140397891 16:74644676-74644698 CTTCTATGGATGAGGAAGAAGGG - Exonic
1140663334 16:77208450-77208472 CTTCTTTGCTGGGCCAAGAAGGG - Exonic
1141088223 16:81111786-81111808 CTGCTGTGCTGGGGGATGGATGG - Intergenic
1141105368 16:81229104-81229126 CTTCGGGGCTGGAGAAGGAAGGG - Intergenic
1141142389 16:81505151-81505173 CTGCTGTCCTGGAGGCAGGACGG + Intronic
1141581504 16:85002757-85002779 CTTCCTCCCTGGAGGAAGAAAGG + Intronic
1141599827 16:85118894-85118916 CTGCTGGCCTGGAGGAAGATGGG - Intergenic
1203050089 16_KI270728v1_random:867825-867847 CAGCTGTGGTGGAGGATGAATGG - Intergenic
1143208616 17:5165903-5165925 CTACAGTGCTAGAGGAAGACAGG - Intronic
1144447422 17:15343987-15344009 CTTTAGTGCTGGAGGAGAAATGG - Intergenic
1144617944 17:16794014-16794036 CTACAGTGCTAGAGGAAGACAGG - Intronic
1145137463 17:20422562-20422584 CTACAGTGCTAGAGGAAGACAGG - Intergenic
1146055411 17:29578364-29578386 TTGCTGAGCTGGAGGAAGAGAGG + Exonic
1147329514 17:39688768-39688790 ATTCTGTGCTGGAGGTAGAGTGG - Intronic
1147558197 17:41492966-41492988 CTTGGGGGCAGGAGGAAGAAGGG + Intergenic
1150880125 17:69015070-69015092 CTGCTATGCTGGAGGCAGAATGG - Intronic
1151889902 17:76945921-76945943 ATTCTGTGCTGGGGGAAGTCTGG + Intronic
1152559631 17:81071531-81071553 TTTCTCTGCTGGTGGAAGAGGGG - Intronic
1152647492 17:81476228-81476250 CTGCTGTGCTCCAGGAAGATGGG + Intergenic
1153071860 18:1115583-1115605 CTGCTGTGGTGGAGGTAGCAGGG + Intergenic
1153361243 18:4199203-4199225 CTTCTGTCCTGGAGGAGGGTGGG + Intronic
1157542555 18:48522023-48522045 CTTCTGTGCTGTTTGGAGAAAGG - Intergenic
1158064796 18:53393852-53393874 CTTCTGTCAGGGAGGATGAAGGG - Intronic
1158409718 18:57194647-57194669 CTTCTGAGCGGGAGAAAAAAGGG + Intergenic
1158936828 18:62372448-62372470 CTTCTGAGCTGGAGAAAGTTGGG + Intronic
1159095814 18:63900479-63900501 CTTCTCTGCAGGAGGAATCATGG - Intronic
1159995747 18:74962417-74962439 CCTCTGTGCTGGAGAAACAGGGG - Intronic
1161345437 19:3766825-3766847 CTGGTGTGCTGGAGGAACAGCGG + Intronic
1161778758 19:6278278-6278300 CTTCTGGGCTTGAGGAAGAGGGG + Intronic
1162418437 19:10552270-10552292 CTTCTATGCTGGAGACAGGAAGG + Exonic
1162740767 19:12772388-12772410 CCTCTGTGTTGGAGGCAGGAGGG - Intronic
1162953181 19:14083870-14083892 GGTCTCTGCTGAAGGAAGAAGGG + Exonic
1163211843 19:15846610-15846632 CTTGTGTCTTGGGGGAAGAAAGG + Intergenic
1165037570 19:33044976-33044998 TTTCTGTCCTGGAGGATGATTGG - Intronic
1165135836 19:33668109-33668131 TGTCTCTGCTGGAGAAAGAATGG + Intronic
1165462848 19:35954222-35954244 CTTCTGTGCCTGAGGAAGGAGGG - Intergenic
1165694055 19:37886801-37886823 CTTCTGAGGAGGAGGAGGAAAGG - Exonic
1165966415 19:39584586-39584608 GTTCTGTACTGGGGAAAGAAAGG + Intergenic
1166148098 19:40850876-40850898 CTTCTGTTGTGGAGGATGCAGGG + Intronic
1166171121 19:41028172-41028194 CTTCTGTTGTGGAGGATGCAGGG + Intergenic
1166177929 19:41088001-41088023 CTTCTGTTGTGGAGGATGCAGGG - Intergenic
1166783529 19:45354404-45354426 CATCTGTGCTGGAGGATAACAGG + Intronic
925527717 2:4822061-4822083 ATTCCGTGCTGGAGGGAGCATGG - Intergenic
926510449 2:13770710-13770732 CTTCTGTTCTGGAAGAGGAAAGG - Intergenic
926731253 2:16037379-16037401 CTTCTCTGCTGCATTAAGAATGG - Intergenic
926774093 2:16405050-16405072 CTCCTCTCCTGGAGGTAGAAGGG + Intergenic
927931087 2:27044837-27044859 CTTCGGCTCTGGGGGAAGAAGGG - Intronic
929361794 2:41100990-41101012 CTTCTTTGGTGGTGGAGGAAGGG - Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930269614 2:49241022-49241044 CTTTGGTGCTGAAGGGAGAAGGG + Intergenic
930469640 2:51795778-51795800 CTGCTCTGCTGGAGGTAGCAGGG - Intergenic
930942952 2:57035689-57035711 CTGCTGTGCTGGAGGAACCAAGG + Intergenic
931234929 2:60405377-60405399 CTTCTGTGCTGGAGCATGTGCGG - Intergenic
934649904 2:96084819-96084841 CTGCTGGGCTGGAGGAGGCAAGG + Intergenic
935112632 2:100106148-100106170 ATTCAGAGCTGGGGGAAGAAGGG - Intronic
936368648 2:111884080-111884102 CCCCTATTCTGGAGGAAGAACGG + Exonic
936998756 2:118442225-118442247 CTTCTCTGCAAGTGGAAGAAGGG - Intergenic
939076281 2:137606419-137606441 ATTCTTTGGTGGAAGAAGAAAGG + Intronic
939541641 2:143502012-143502034 CTTCTGTCCTGGATGAAGTAAGG - Intronic
940849159 2:158671995-158672017 CTTGTGTGCTTGAGGAACAGAGG + Intronic
941174829 2:162184006-162184028 CTTCTGTGATGGAGCTAAAAAGG - Intronic
941387356 2:164869644-164869666 CTTCTGTTCAGGAGGAAGACTGG + Intergenic
942089101 2:172471351-172471373 CTTCTGAGCAGGAGGGAGGACGG - Intronic
942624867 2:177889227-177889249 CTCCTGTGCTGGAGGACAATGGG - Intronic
942738137 2:179139985-179140007 CTTCTGTGTCGCAGGAAGGATGG - Intronic
942901452 2:181124758-181124780 ATTCTGTGAAGGAGGAAGTAGGG - Intergenic
943660233 2:190552214-190552236 CATCTGAGCAGGAGGAAGCAAGG - Intergenic
945121090 2:206458103-206458125 TCTCTCTTCTGGAGGAAGAATGG + Intronic
945662319 2:212701730-212701752 CTTCTTTGCTGGAGAAAAAGAGG - Intergenic
945920253 2:215748536-215748558 CAGCTGTGCTGGAGGAACTAAGG + Intergenic
945958174 2:216105620-216105642 CTTTTGTTGTGGAGGAGGAAGGG + Intergenic
946401584 2:219471409-219471431 CAGCTGTGCTGGAGACAGAATGG + Intronic
947296235 2:228633857-228633879 CTTCTTTGCTGGAGGGATTAAGG + Intergenic
947758200 2:232584433-232584455 CTTCCATGCTGCAGGAAGAAGGG - Intergenic
948372489 2:237498464-237498486 CTGATATGCTGGAGGAAGGAGGG + Intronic
948576779 2:238956896-238956918 CTGCTCTGGTGGAGGAAGCAGGG - Intergenic
948793630 2:240391494-240391516 CCTCAGTCCTGGAGGAAGAGGGG - Intergenic
1170259963 20:14393603-14393625 CTTCTGTGTTGGTGGGAGAGAGG - Intronic
1170741097 20:19057198-19057220 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1171233044 20:23502542-23502564 CTTATGTGCAGCAGGAAGCAGGG - Intergenic
1171974943 20:31588210-31588232 GTTCGGTGCAGGAGGAAGAGCGG - Intergenic
1172882323 20:38210097-38210119 CTGCTGTGGTGGAAGAAGATGGG - Intergenic
1173041506 20:39468352-39468374 TTTCAGTGCTGGAGGAAAAATGG + Intergenic
1173099724 20:40074432-40074454 CTTCTGTGCTAGAGGCAGGAAGG - Intergenic
1173365597 20:42381817-42381839 TTTCTGTGTTGAAGGTAGAAGGG - Intronic
1174244751 20:49169728-49169750 CATCTGTGTGGGAGGCAGAAAGG - Intronic
1174249416 20:49207331-49207353 CTTCTGTCCTGGAGGAGCCAGGG + Intergenic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1174767206 20:53265487-53265509 CTGCGGGGCTGGAGGAGGAAAGG - Intronic
1178055809 21:28797223-28797245 CTCCTGTTCTGAAGGAACAAAGG + Intergenic
1181326135 22:22047899-22047921 CCTCCGTTCTGTAGGAAGAAGGG - Intergenic
1183226705 22:36555266-36555288 CTCATGTGCTATAGGAAGAAAGG - Intergenic
1184069934 22:42141394-42141416 CTCCTGTGTTGGAGGAAGTTAGG + Intergenic
1185109962 22:48895318-48895340 CTTCTGTGTAGGAGGCAGGAGGG + Intergenic
949280533 3:2341633-2341655 AATCTGTGGTAGAGGAAGAAAGG - Intronic
950111469 3:10421396-10421418 CTCCTCTGCTGCAGGAAGAGAGG - Intronic
950479568 3:13236121-13236143 CTTCTGTGCAGCGGGAACAAAGG - Intergenic
950626786 3:14253195-14253217 CTTCTGTGCTGGGCGAAGTAGGG + Intergenic
952210449 3:31224528-31224550 CTTCTGTGCTGGAGAAGGCTGGG + Intergenic
952916882 3:38253129-38253151 CTTCTCAGATGGAGGAAGACAGG - Exonic
953146551 3:40281371-40281393 CTGCTGTTTTGGAGGAACAAAGG - Intergenic
953429784 3:42829671-42829693 CAACTGTGCTATAGGAAGAAGGG - Intronic
953752054 3:45616487-45616509 ATTCTGTGGGTGAGGAAGAAGGG - Intronic
954150675 3:48655681-48655703 CGTGTGTGCTGGAGGACGCAGGG - Intronic
954624864 3:52016821-52016843 CATCTGAGCTGGAGGAGGAGGGG + Intergenic
954989234 3:54825254-54825276 CTTCTGTGTAGAAGGAAGAAGGG - Intronic
956267832 3:67417708-67417730 TTTCTCTGCTGGAGGAAAAGGGG - Intronic
956482541 3:69687613-69687635 CTTGTGTGATGGAGGAGTAAAGG + Intergenic
956493488 3:69799271-69799293 TGTCTGTGCAGGAGGACGAATGG + Intronic
956847019 3:73193097-73193119 CTACTGTGCTCAAGGAAGAGGGG + Intergenic
957878845 3:86183981-86184003 CATGTGTGCTGGTGGAGGAAAGG - Intergenic
958726892 3:97916863-97916885 CTTGTCTGTTGGAGGAAAAATGG + Intronic
958785175 3:98590088-98590110 CTTCTATGTTGGAGGAAATATGG + Intronic
959179014 3:102955017-102955039 CTTTTTTCCTGGAGGAAGAGAGG - Intergenic
959733621 3:109632207-109632229 CATCTCTGCTGGAAGGAGAAGGG + Intergenic
961101286 3:124201370-124201392 CTTCCTTGCAGGAGGAACAATGG + Intronic
961333950 3:126159029-126159051 GTTCCCTGATGGAGGAAGAAGGG + Intronic
961412832 3:126735260-126735282 CTCCTTTGCAGGAGTAAGAATGG - Intronic
961455644 3:127022632-127022654 CTTCGGTGCTGTAGGAAGGGGGG + Intronic
961474471 3:127138129-127138151 CATCTGTGCTTGAGGAGGATTGG + Intergenic
961704766 3:128775357-128775379 CTTCTCTGCTAGTGGAGGAAGGG - Intronic
961747891 3:129077193-129077215 CTAAAGTGCTGGATGAAGAAAGG + Intergenic
962362065 3:134750765-134750787 TTTCTGGGCTGGCAGAAGAAAGG + Intronic
962493102 3:135912544-135912566 CATATTTGCTGGAGGAAGTAGGG - Intergenic
963631144 3:147731633-147731655 ATTTTGTGGTGGAGGAAGAAAGG + Intergenic
964514497 3:157493237-157493259 CTTCTGTGCTGGAAGTTGGAAGG + Intronic
965888279 3:173476877-173476899 ATTATGTGTTGGAGAAAGAAGGG + Intronic
966072660 3:175898057-175898079 CTTCTCTTCTGGAGGTAGATAGG + Intergenic
967957022 3:194885158-194885180 CCGCTGTGATGGAGGAAGAGTGG + Intergenic
968441715 4:627732-627754 ATTGTGTGCAGGAGGAAGGAAGG - Intronic
968787891 4:2637621-2637643 CTGCTGAGCTAGAGGCAGAAAGG - Intronic
970069954 4:12146653-12146675 GTTCAGAGCTTGAGGAAGAAAGG + Intergenic
970443229 4:16102734-16102756 CTTCTGTGTTGTAGTAGGAAGGG - Intergenic
970654155 4:18212948-18212970 CTGCTGTGCTGGAGGAGCCAAGG + Intergenic
972011965 4:34194282-34194304 CTTCATTGCTGTAGGAAGAATGG + Intergenic
974372246 4:61032594-61032616 CTGCAGTGCTGAGGGAAGAAGGG - Intergenic
975251544 4:72185136-72185158 CTTCAGTGCTGGGAGGAGAAAGG + Intergenic
975321663 4:73015416-73015438 CTGGTGTTCTGGAGGAAGAGTGG - Intergenic
977042938 4:92037169-92037191 CTTCTGTGATGAAGGAAGGCGGG - Intergenic
980156318 4:129111246-129111268 CTTCTCTGCTGAAGCAAGAGAGG - Intronic
981640565 4:146939107-146939129 CTTCTGTTTTGGAAGAAGGAGGG - Intronic
982059559 4:151591182-151591204 CTTATGTGGTTGATGAAGAAAGG + Intronic
982091759 4:151885654-151885676 CTTCAGTGTTGGGGTAAGAACGG - Intergenic
983512384 4:168622519-168622541 CTTCTGGGCTGAAAGAAAAAAGG - Intronic
984256867 4:177400009-177400031 CTCATGTGCTGGAGGGAGAAAGG - Intergenic
984869074 4:184310997-184311019 CCTCTCTGCTGTAGGCAGAAGGG + Intergenic
985588481 5:752886-752908 CTTCTTTCCTGGATGAAGAGGGG - Intronic
985603152 5:845341-845363 CTTCTTTCCTGGATGAAGAGGGG - Intronic
985907341 5:2850656-2850678 TTTCTGTGCTGCAGGATAAAAGG - Intergenic
985992364 5:3574084-3574106 CTTCTGTGCTAGATGAAGGTAGG - Intergenic
986296668 5:6445076-6445098 CTTCTGAGATGGAAGAAGGAGGG + Intergenic
986548662 5:8927644-8927666 CTTGGGTGCTGGAGGAAAGAAGG + Intergenic
986573955 5:9193487-9193509 CTAGTGTGCTGGAACAAGAATGG - Intronic
986582619 5:9281216-9281238 ATTCTGTGCTAGAGGGAAAATGG - Intronic
986728721 5:10619279-10619301 CTTGTGTGTTGAAGGAAGGAGGG + Intronic
987403957 5:17506453-17506475 CTTCCTAGTTGGAGGAAGAAAGG - Intergenic
987411428 5:17619201-17619223 CTTCCTAGTTGGAGGAAGAAAGG - Intergenic
987413850 5:17642513-17642535 CTTCCTAGTTGGAGGAAGAAAGG - Intergenic
988822071 5:34896958-34896980 GTTCTCTGGGGGAGGAAGAAAGG + Intronic
989128393 5:38079244-38079266 CTGCTCTGCTGGAGGATGATAGG + Intergenic
989206072 5:38809928-38809950 CTTCTGTGAGGCAGGAACAAAGG - Intergenic
989246655 5:39262939-39262961 TTTCTGTGCTGTGGGAAGGAGGG + Intronic
989437157 5:41428178-41428200 CCTGTGTGCTAGAGGCAGAAAGG - Intronic
990283693 5:54278401-54278423 GTTCTGTTCAGGAGGAAGGAGGG - Intronic
990557492 5:56951397-56951419 TCTCTGGGCTGGAGGAAGGAAGG - Intronic
991655265 5:68897758-68897780 CGTCTGTGTTGGAGTAAGATTGG - Intergenic
992382781 5:76255415-76255437 ATTCTGGGGTGGAGGAAGACAGG - Intronic
992448105 5:76851616-76851638 CCTCTGGGGTAGAGGAAGAAGGG + Intronic
992531355 5:77654465-77654487 CTGCTGTGCTGGGGGTAGCATGG - Intergenic
993228677 5:85204096-85204118 CTACTGTGCTGGAGGAGCAAAGG + Intergenic
994163867 5:96587253-96587275 CTTCTGAGCTAGAGGGACAAAGG - Intronic
994248812 5:97512866-97512888 TTTCTTTGCTGGAGGAACGAGGG - Intergenic
995068915 5:107895248-107895270 CTTGTATGCTTGAGGAAGACTGG + Intronic
995444003 5:112222795-112222817 CTTCTCTCCTGGGGTAAGAATGG - Intronic
996026558 5:118652912-118652934 CTTTTGTGATGGGGGAAAAATGG + Intergenic
996819795 5:127613611-127613633 TGTCTGGGCTGGAGGAAAAAAGG + Intergenic
997405969 5:133647071-133647093 CTCCTGTGCTGCATGAAGAGCGG + Intergenic
997669768 5:135661184-135661206 CTGCTGTTCTGGAGGCAGACAGG - Intergenic
997972918 5:138418997-138419019 CTTCTCTGGTGGAGGAGGACCGG + Exonic
999393122 5:151208678-151208700 ACCCTGGGCTGGAGGAAGAAGGG + Intronic
999691512 5:154150045-154150067 CTTGTGACCAGGAGGAAGAAAGG - Intronic
1001676680 5:173523945-173523967 ATTCTGGGTTGGAGGAAGATAGG + Intergenic
1001836972 5:174840796-174840818 CTTCTCTGCAGGAAGAAGAGGGG + Intergenic
1001920344 5:175594840-175594862 CATCTGAGTTGGTGGAAGAAGGG - Intergenic
1001989173 5:176101974-176101996 CAGCTGTGGTGGAGGATGAATGG - Intronic
1001989842 5:176107298-176107320 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002227029 5:177730840-177730862 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002227697 5:177736164-177736186 CAGCTGTGGTGGAGGATGAATGG + Intronic
1002266449 5:178037589-178037611 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002267119 5:178042934-178042956 CAGCTGTGGTGGAGGATGAATGG - Intronic
1002297872 5:178241406-178241428 CTTCTGGGAAGGAGGAAGGAAGG + Intronic
1002490042 5:179569322-179569344 CTTTAATGATGGAGGAAGAAGGG + Exonic
1002816045 6:681456-681478 CTTCTTTGGTGGGGGGAGAAAGG - Intronic
1006415953 6:33904048-33904070 CTTCCCTGCTGGGAGAAGAAAGG - Intergenic
1006421323 6:33935830-33935852 CTTCCGTGCTGGAGGTAGGAGGG + Intergenic
1006679578 6:35787454-35787476 CTCCTGAGCTGGATGAAGACGGG - Intronic
1006936650 6:37723406-37723428 TTTGTGTGGTGGAGGAAGGAAGG - Intergenic
1007878984 6:45140656-45140678 CTGCTGTGCTGGAGGTGGCAGGG - Intronic
1008142678 6:47850130-47850152 CATCTGGGCTTGAGCAAGAACGG + Intergenic
1008295237 6:49767640-49767662 CTTCTTTGCTGTAGGAACAAAGG + Intergenic
1009404827 6:63299285-63299307 CCTCTGTGCAGCAGGAAGAGAGG + Intronic
1009546810 6:65030648-65030670 CTGCTGTGTTGGAGGAATCAAGG - Intronic
1011029007 6:82900756-82900778 ATTCTGTCCAGCAGGAAGAATGG + Intronic
1011719507 6:90140676-90140698 CATATGAGGTGGAGGAAGAAGGG + Intronic
1012133044 6:95519944-95519966 CTTCTGAGCCTGTGGAAGAAGGG + Intergenic
1015330190 6:131968837-131968859 CATGTGCTCTGGAGGAAGAAGGG + Intergenic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1015896924 6:138026451-138026473 CTTCTGCGCTGGAGGAAGCAAGG + Intergenic
1016246990 6:141994577-141994599 CTTCTCTGCTGGAGGCAGTGTGG - Intergenic
1016607841 6:145953749-145953771 ATTCTATGCTGTAAGAAGAATGG + Intronic
1018757679 6:166863421-166863443 CTTCTGTCCTGGATAATGAAAGG + Intronic
1018894762 6:168006023-168006045 CTTCAGTGCAGGAGGAAGAGGGG + Intronic
1019228849 6:170540222-170540244 CTTCTGTGTTGGTGGATGCAGGG - Intronic
1019319469 7:409078-409100 GCTCTGTGCTGGAGGAGGCACGG + Intergenic
1020032991 7:4945880-4945902 CCTCTGTCCTGGAGGAAAGAAGG - Intronic
1020090133 7:5334112-5334134 CTCCTGTGCTGGAGGATTTAAGG - Intronic
1020821701 7:12976567-12976589 CATCTGTGCAGGAGAAAGCATGG - Intergenic
1021909023 7:25365589-25365611 CTTCTGTGCTGTAGGCAGCTGGG + Intergenic
1022833700 7:34093849-34093871 CTTCTTAGCAGGAGGCAGAATGG + Intronic
1022921455 7:35019911-35019933 CTACTCGGCTGGAGGAAGTAGGG + Intronic
1023141957 7:37110720-37110742 CTCCTCTGATGGAAGAAGAAAGG + Intronic
1023183270 7:37507863-37507885 CTTCTCTGCAGGAGGAAGGAAGG + Intergenic
1024761498 7:52602444-52602466 CTTCTGTGCTAGAGCCATAAAGG + Intergenic
1026073571 7:67144789-67144811 CTGCTGTGCTGTAGGAAGTTTGG - Intronic
1026703314 7:72667391-72667413 CTGCTGTGCTGTAGGAAGTTTGG + Intronic
1026742977 7:72990438-72990460 CTTCTGTGCTGGGGGTGGGATGG + Intergenic
1026779751 7:73257510-73257532 CTTCATTGCTTGTGGAAGAAGGG + Intergenic
1027020606 7:74810923-74810945 CTTCATTGCTTGTGGAAGAAGGG + Exonic
1027067419 7:75135008-75135030 CTTCATTGCTTGTGGAAGAAGGG - Exonic
1027392689 7:77721094-77721116 CTTGGGTGGTGGTGGAAGAAAGG + Intronic
1027443499 7:78245809-78245831 CTTCTTTTCTGGAGGGAGCATGG - Intronic
1029005250 7:97202382-97202404 CATCTGTGCAGTAGGAACAAAGG + Intergenic
1029307662 7:99632434-99632456 CTTCAGTGGGGGAGGAAGACGGG - Intergenic
1029667224 7:102003527-102003549 AGTCTGAGCTGGAGGAAGGAAGG + Intronic
1030060613 7:105618089-105618111 TTTCTGTGCCTGAGGAGGAAAGG + Intronic
1030065954 7:105659412-105659434 CTACTGGGCAGGAGGAAGACAGG + Intronic
1030318907 7:108144152-108144174 CATCTGTGCTGGAGGAGGGATGG + Intergenic
1035161821 7:156956252-156956274 CTTCTGTGCTGAAGGCGGCATGG + Intronic
1035330532 7:158094206-158094228 CCCCTGTGCTGGGGGAACAAGGG - Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1037189749 8:16109240-16109262 CTTCAGTGCAGAAGGAAGAGTGG - Intronic
1037617579 8:20533511-20533533 CTGCTGTGATGGGGGAAGAAGGG - Intergenic
1037742777 8:21620625-21620647 CTTCCCTGCTGGGGGAAGCAGGG + Intergenic
1038069752 8:24000928-24000950 CTTGTGGACTGGAGAAAGAAAGG - Intergenic
1038765913 8:30427478-30427500 TTCCTGTAGTGGAGGAAGAATGG - Intronic
1039882324 8:41632687-41632709 CTTCTGGGCTGGCGGAGGGAAGG + Intergenic
1041036448 8:53796068-53796090 CTGCTGTGCGGCAAGAAGAAAGG + Intronic
1042716183 8:71775207-71775229 CTTGTGGGCTGAGGGAAGAATGG + Intergenic
1043973802 8:86563134-86563156 CTGCTGTGTTGGAGTAAGACTGG + Intronic
1047755125 8:127912582-127912604 CTATTGTGATAGAGGAAGAAAGG + Intergenic
1047950790 8:129932984-129933006 CCTCTGGGCTGGTGGAAGGAGGG + Intronic
1048379570 8:133853353-133853375 CTTGTGTGCTGGTGGAAGAGTGG + Intergenic
1048828655 8:138454602-138454624 CCTGAGTGATGGAGGAAGAAAGG - Intronic
1048989254 8:139751745-139751767 CTTGTCTGCTGGAGGATGGATGG - Intronic
1049048326 8:140170803-140170825 CTCCTGTGCTGGGGTGAGAATGG + Intronic
1049635774 8:143688368-143688390 CTGCTGTGCTGGAGGTGGGAGGG + Intronic
1051681324 9:19610936-19610958 CTGCTCTGTTGGAGGAATAAGGG + Intronic
1051936277 9:22446797-22446819 CTTCTTGGCTGGAGGCACAAAGG + Intergenic
1051957235 9:22711239-22711261 ATTCTGTTCTGGAGGAAACAAGG - Intergenic
1052201073 9:25781020-25781042 CTTCTGTACTGAAGGAAAAGGGG - Intergenic
1053148447 9:35727796-35727818 CTTCCGTGCTTGAGGAGGAAGGG - Intronic
1053512696 9:38702290-38702312 CTTCTCTGCTTATGGAAGAAGGG + Intergenic
1054959703 9:70954246-70954268 CCACTGGGCTGGAGGAATAATGG - Intronic
1055137966 9:72844637-72844659 CTGCTGTGGTGGAGGTAGCAGGG - Intergenic
1055541543 9:77311282-77311304 CTTATGGGCTGGAGGAAGAAGGG - Intronic
1055906153 9:81295335-81295357 CTTCTGTCGGGGAGGGAGAAAGG + Intergenic
1055906833 9:81304588-81304610 ATTTTGTCCTGGAGGCAGAAAGG + Intergenic
1056201389 9:84280251-84280273 ATTCTCTGCTGTGGGAAGAAGGG + Intronic
1056286246 9:85090661-85090683 CAGCTGTGAGGGAGGAAGAATGG + Intergenic
1056468911 9:86886270-86886292 CTTCTCTGCTGGAAGGAGTAAGG - Intergenic
1057185484 9:93055285-93055307 CTTCCCTGCTGGAGGAGGCAGGG - Intergenic
1057576924 9:96250094-96250116 ATTCTCAGCTGGAGGAAGAGGGG + Intronic
1057791939 9:98130437-98130459 CTTCTGTCTTAGAGGAAAAAGGG - Intronic
1059562661 9:115350397-115350419 CTTCTGGGTGGGAGGAAAAAGGG + Intronic
1059663554 9:116425025-116425047 AAGCTGTGCTAGAGGAAGAATGG - Intergenic
1059710059 9:116859582-116859604 CATCTGAGCTGGTGGAAGACAGG + Intronic
1060015242 9:120081039-120081061 GTTCTGTGTAGGGGGAAGAAGGG + Intergenic
1060293345 9:122324740-122324762 CTCCTGTGCTGGAGGTAATAAGG + Intergenic
1060389412 9:123266875-123266897 ATTTTGTGCTGTAGGGAGAAGGG - Intronic
1060679134 9:125545864-125545886 ATTGTGTGGTGGAGGAATAAAGG + Intronic
1060714592 9:125911993-125912015 CTTCAGTGCTGGATGAACAGAGG + Intronic
1060742305 9:126107343-126107365 CTCCTGTTCAGGATGAAGAAAGG - Intergenic
1060944490 9:127561916-127561938 CTTCTGTGCTGGAGGAAGAAGGG - Intronic
1062059664 9:134488309-134488331 CCTCTGTCCTGGAGGAAATAAGG - Intergenic
1062432294 9:136531611-136531633 CTGCTGGGCGGGAGGAAGGAAGG - Intronic
1186644054 X:11487345-11487367 CTTGAGAGCTGGAGCAAGAAAGG + Intronic
1186737483 X:12481075-12481097 CTTGTTGCCTGGAGGAAGAAAGG + Intronic
1186849586 X:13567596-13567618 CTTCTGTGCTGAAGACAGAGTGG - Intergenic
1186916903 X:14232819-14232841 CTTATCTGCTGGAGGATGAGAGG + Intergenic
1187016291 X:15332771-15332793 CTACTGTGCTAGAGGGACAAGGG + Intronic
1188601820 X:31976050-31976072 ATTCTCTGCTGGAGGATGAATGG + Intronic
1193165692 X:78277550-78277572 CTGCTGTGCTGGAGGAACCAAGG - Intronic
1195432311 X:104803082-104803104 CTGCTGTTGGGGAGGAAGAAAGG + Intronic
1195817363 X:108903320-108903342 CTTCTCTGCTAGATGTAGAAGGG - Intergenic
1196984268 X:121251178-121251200 CATCTTCACTGGAGGAAGAAAGG - Intergenic
1197140724 X:123114809-123114831 CTCCTGTGCTGGAGGTAATAAGG - Intergenic
1197706775 X:129639859-129639881 CTGCAGTGCTGGAGGTGGAAGGG + Intergenic
1197851837 X:130870502-130870524 ATTCTGTCCTGGTGGTAGAATGG - Intronic
1198868284 X:141148638-141148660 CTTCTGTGCTAGAGGGACCAAGG + Intergenic
1199833430 X:151565453-151565475 GTTCTTTGCTGATGGAAGAAAGG - Intronic