ID: 1060945830

View in Genome Browser
Species Human (GRCh38)
Location 9:127568994-127569016
Sequence CAGCCGGGCGGCGGGAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 722
Summary {0: 1, 1: 0, 2: 6, 3: 76, 4: 639}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060945830_1060945841 8 Left 1060945830 9:127568994-127569016 CCGCCGCTCCCGCCGCCCGGCTG 0: 1
1: 0
2: 6
3: 76
4: 639
Right 1060945841 9:127569025-127569047 GCTCCGGCTCCGCTCCCGGTCGG 0: 1
1: 0
2: 1
3: 11
4: 123
1060945830_1060945837 -8 Left 1060945830 9:127568994-127569016 CCGCCGCTCCCGCCGCCCGGCTG 0: 1
1: 0
2: 6
3: 76
4: 639
Right 1060945837 9:127569009-127569031 CCCGGCTGCGGCTTCCGCTCCGG 0: 1
1: 0
2: 3
3: 19
4: 257
1060945830_1060945847 27 Left 1060945830 9:127568994-127569016 CCGCCGCTCCCGCCGCCCGGCTG 0: 1
1: 0
2: 6
3: 76
4: 639
Right 1060945847 9:127569044-127569066 TCGGGCCCCGTCCCTCCAGCCGG 0: 1
1: 0
2: 5
3: 12
4: 164
1060945830_1060945839 4 Left 1060945830 9:127568994-127569016 CCGCCGCTCCCGCCGCCCGGCTG 0: 1
1: 0
2: 6
3: 76
4: 639
Right 1060945839 9:127569021-127569043 TTCCGCTCCGGCTCCGCTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 110
1060945830_1060945842 9 Left 1060945830 9:127568994-127569016 CCGCCGCTCCCGCCGCCCGGCTG 0: 1
1: 0
2: 6
3: 76
4: 639
Right 1060945842 9:127569026-127569048 CTCCGGCTCCGCTCCCGGTCGGG 0: 1
1: 0
2: 1
3: 10
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060945830 Original CRISPR CAGCCGGGCGGCGGGAGCGG CGG (reversed) Exonic