ID: 1060952265

View in Genome Browser
Species Human (GRCh38)
Location 9:127612017-127612039
Sequence CCGCGCGCGCCCGGGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 231}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060952265_1060952274 -7 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952274 9:127612033-127612055 CGCGCGGCGCGTGAGGTGAGGGG 0: 1
1: 0
2: 1
3: 1
4: 145
1060952265_1060952278 3 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952278 9:127612043-127612065 GTGAGGTGAGGGGGAGGGCGCGG 0: 1
1: 0
2: 17
3: 279
4: 3087
1060952265_1060952279 21 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952279 9:127612061-127612083 CGCGGCTCCGCACCAGCCAGCGG 0: 1
1: 0
2: 0
3: 9
4: 119
1060952265_1060952276 -3 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952276 9:127612037-127612059 CGGCGCGTGAGGTGAGGGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 284
1060952265_1060952275 -6 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952275 9:127612034-127612056 GCGCGGCGCGTGAGGTGAGGGGG 0: 1
1: 0
2: 3
3: 11
4: 134
1060952265_1060952272 -9 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952272 9:127612031-127612053 CGCGCGCGGCGCGTGAGGTGAGG 0: 1
1: 0
2: 1
3: 6
4: 145
1060952265_1060952277 -2 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952277 9:127612038-127612060 GGCGCGTGAGGTGAGGGGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 599
1060952265_1060952273 -8 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952273 9:127612032-127612054 GCGCGCGGCGCGTGAGGTGAGGG 0: 1
1: 0
2: 1
3: 3
4: 70
1060952265_1060952281 29 Left 1060952265 9:127612017-127612039 CCCTGCGCCCCGGGCGCGCGCGG 0: 1
1: 0
2: 1
3: 24
4: 231
Right 1060952281 9:127612069-127612091 CGCACCAGCCAGCGGCCGCCTGG 0: 1
1: 0
2: 1
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060952265 Original CRISPR CCGCGCGCGCCCGGGGCGCA GGG (reversed) Intergenic
900227570 1:1540239-1540261 GCGCGCGCGGGCGGGGAGCAGGG + Intronic
900237600 1:1600138-1600160 CCGAGCGCGCACGGGGCGCGGGG - Intergenic
900349650 1:2228461-2228483 CCGCGCGCCCCCCGGGCTCTAGG - Intergenic
901075789 1:6554128-6554150 CAACGCGCGGCCGGGGCCCACGG + Exonic
901109643 1:6784953-6784975 CCGCGTGCTCCCGGGGCTGAAGG - Intergenic
901641370 1:10694691-10694713 GCGCGCGCGGCGGGGGCGCGCGG - Intronic
902311513 1:15584926-15584948 CCGGGTGCGCCCGGGGCCCGGGG - Exonic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903795116 1:25922915-25922937 CCGCGTGCGCCCGGGGGTCTGGG - Intergenic
904822888 1:33256657-33256679 CCGCGCGCCCCGGGCCCGCACGG - Intronic
904822889 1:33256657-33256679 CCGTGCGGGCCCGGGGCGCGCGG + Intronic
905685082 1:39902038-39902060 CGTCGCGCGCCCGGGACCCAGGG + Intronic
906290575 1:44617121-44617143 GGGCGCGTGCCGGGGGCGCAGGG - Intronic
906532836 1:46533245-46533267 CCGAGCGCCCACGGGGCGCGAGG + Intergenic
906680987 1:47725356-47725378 CGGCGCCCGCCCGGGGCACCCGG + Intergenic
907513800 1:54980805-54980827 CCGCCCGCACCCGGTGCGCAGGG - Exonic
912270150 1:108200318-108200340 CCGAGCCCGCGCGGAGCGCAGGG + Exonic
912505063 1:110150654-110150676 CGCCGCGCGCTCGGGGCTCAGGG - Exonic
912716875 1:111989533-111989555 CCTCGCGCGCGCGGGGCGCCGGG - Intergenic
916750835 1:167721827-167721849 CCGCGCGGGGCCGAGGCGCCTGG + Intronic
919640388 1:200039867-200039889 CCGCGCCCGCGCGGGGCGGGAGG - Intronic
919809426 1:201399412-201399434 CGGAGCGCGGCCGGGGCGCGCGG - Exonic
921152741 1:212414789-212414811 CCGCCCCAGCCCGCGGCGCACGG + Exonic
922602841 1:226870484-226870506 CCCCGCGCGCCCGGGACTCCAGG + Intronic
922739288 1:228006624-228006646 CCCCGCGCGCCCTGCGCTCACGG - Intergenic
1062843862 10:689920-689942 GCGCGCGCGCGCGGGGCGCGAGG + Intergenic
1063449966 10:6144777-6144799 CCGAGGGCGCCCGGAGCTCACGG + Intergenic
1063459091 10:6204052-6204074 GTGCGTGCGCCCGGGGCGCGTGG - Intronic
1064086435 10:12349416-12349438 CGGGGAGCGGCCGGGGCGCACGG + Intergenic
1064167784 10:13001572-13001594 CCGGGCCCTCCCGGGGCGCACGG + Exonic
1064392470 10:14953861-14953883 TCGCCCGCTCCCGGGGCGCTGGG - Intronic
1064552847 10:16520740-16520762 CCGGGCCCGCCCGGGGCGCCCGG - Exonic
1065099107 10:22316329-22316351 CCGCGCGCGCACGCGGCTCGGGG - Exonic
1069662478 10:70132677-70132699 CCGGTCCCGCCCGGGGCGCCCGG + Intronic
1070570759 10:77638055-77638077 CAGCGCACACCCGTGGCGCACGG - Intronic
1072421083 10:95291015-95291037 CGGCGCGGGCCCGGGGAGCCTGG + Exonic
1072719395 10:97771423-97771445 CGGCGCGCAGCCGGCGCGCACGG + Exonic
1073106003 10:101032327-101032349 CCGCGCCCACCCGGTGGGCACGG - Exonic
1073503894 10:103967238-103967260 CCGTCCGCTCCCGCGGCGCAAGG - Exonic
1074721859 10:116271532-116271554 CCGGGCGCGCGCTGGGCGCGGGG + Intronic
1074814524 10:117134396-117134418 CCGAGAGCGCCCGTGGCGCAAGG + Exonic
1075334566 10:121598716-121598738 CCTCGCTCGCCCGGGGAGGAGGG - Intergenic
1076000038 10:126906362-126906384 CTGCGGGTCCCCGGGGCGCAAGG - Intronic
1076723484 10:132402912-132402934 CCGCTGGCCCCCGGGGTGCATGG + Intronic
1076892805 10:133293014-133293036 GCGTGCCCGCCCGGGGGGCATGG - Intronic
1077043681 11:535328-535350 CGGCGCGGGCCGGGGGCGCGGGG - Intronic
1077121466 11:910855-910877 CCGCGCGCCGCCGCCGCGCACGG + Intronic
1077495796 11:2885978-2886000 GGGCGCGCGGCCGGGGCGCGCGG + Intergenic
1081488327 11:43548099-43548121 CCTCACGTGCCCTGGGCGCAGGG + Intergenic
1083800039 11:65041345-65041367 CCGAGCGCGCCCAGCGCGAAAGG + Exonic
1083997213 11:66278401-66278423 CAGCGCGGGGCCCGGGCGCAAGG - Exonic
1084177050 11:67428431-67428453 CTGCGCGCGCCGGTGACGCAAGG - Intergenic
1084180500 11:67443403-67443425 CCGGGGGCACCGGGGGCGCAGGG + Exonic
1084516918 11:69642413-69642435 CCGCCCGCGCCCAGGGGGAAGGG + Intronic
1085043958 11:73342898-73342920 CCGCGCGCGCCTGGCTCGCCGGG + Intronic
1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG + Exonic
1089543629 11:119206188-119206210 GCGCGCGAGCCCGGGGCGGGCGG - Exonic
1090653143 11:128824288-128824310 ACGCGCGCGGGCGGGGAGCAGGG + Intergenic
1091266706 11:134276850-134276872 CGGCGCGTGCCTGGGGCGCGTGG - Intronic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1092462507 12:8698425-8698447 CCGAGCGCGCCCGGGGTCCGGGG + Intronic
1094847069 12:34366004-34366026 CCGCGCATGCACGGGGCCCAGGG - Intergenic
1094856934 12:34407031-34407053 CCGCACGTGCCTGGGGCCCAGGG + Intergenic
1096122060 12:49094674-49094696 CCGCCCGCTCCCGGGGCACGTGG - Exonic
1098255378 12:68610841-68610863 CCGCCCGCGGGCGGGGCGCGCGG - Exonic
1102101279 12:110281023-110281045 CCGCGCGCGCCGCGGTCGCGGGG - Intronic
1102854122 12:116278018-116278040 ACGGGCGCGCCCGGGACCCACGG - Intergenic
1103085829 12:118061210-118061232 ACGCGCGGGGGCGGGGCGCAGGG + Intronic
1104021264 12:124993878-124993900 CCGGGCGCGCAGGGGGCGCGGGG + Exonic
1106157381 13:27171442-27171464 CCGCCCCCGCCCGGGCCGCCCGG + Intronic
1106226480 13:27790544-27790566 CCCCGCGTGCCCGGGGAGGAAGG - Intergenic
1106602567 13:31200258-31200280 ACGCGCGCGCCGGCGGGGCAGGG - Intronic
1107549045 13:41457963-41457985 CCGCGCGCGCCCGGGGTTGGGGG + Intronic
1113082828 13:106535550-106535572 CCGCGCGCGTCCGGAGCCCGCGG - Intergenic
1113254868 13:108495795-108495817 CCGCGCCGGCCCCGGGCACAGGG + Intergenic
1113724520 13:112588182-112588204 GCACGCGCGGCCGCGGCGCAGGG - Intergenic
1118808930 14:69260067-69260089 ACGCGCGCGCTCGGGGCTGAAGG + Exonic
1122065825 14:99174030-99174052 CCGCGTGTCCCCGGGGCCCAGGG - Exonic
1122130876 14:99604106-99604128 CCGCGCCCGCCGGGGCCGCCCGG + Intergenic
1122624252 14:103075944-103075966 CCGCGCCCGCCCGGGGTGTTTGG - Intergenic
1123004449 14:105314675-105314697 CCGGGCGCGCGCGGGGCGGCCGG + Exonic
1123076131 14:105668204-105668226 CCGCGAGAGCCCGGGGAGCGGGG + Intergenic
1124790137 15:32718913-32718935 CCGCGCACGCCCGGGCTGAATGG + Intronic
1126626093 15:50686890-50686912 GCGCGTGCGCGCGGCGCGCAGGG - Intergenic
1127674818 15:61228963-61228985 GAGCGGGCGCCCGGGGCGCGGGG - Intronic
1128529023 15:68431640-68431662 CCGGGAGCGCCGAGGGCGCACGG - Intronic
1128547524 15:68578487-68578509 TCGCGCTGGCCCGGGGCACAGGG - Intergenic
1128982531 15:72197785-72197807 CGGCGCGCGGTCGGGGCGCTGGG - Exonic
1129710749 15:77819275-77819297 CCGCGCGCGGACGGCGCGCCCGG - Intronic
1129791207 15:78341630-78341652 CCGCGCCCGCCCGGGTCCCTGGG + Intronic
1130040925 15:80404612-80404634 CCGGGGGCGCCCGGCGCGCCTGG - Intronic
1131517604 15:93089309-93089331 CCGCCCGCGGCCCGGGCGCCCGG - Intergenic
1132320178 15:100919571-100919593 ACGCGGCCGCCCGGAGCGCAGGG - Intronic
1132365081 15:101251430-101251452 CCGCGCGCGGCCGGCGCGCCTGG - Exonic
1132398234 15:101489578-101489600 CCGCGGGCGCGGGGGGCGCGGGG - Exonic
1132527715 16:425890-425912 GCGGGCGCGCGCGGGGCGCCCGG - Exonic
1132724945 16:1334415-1334437 CTGCGGGCGCCCGGGGCCCCGGG + Intronic
1132729056 16:1351764-1351786 GCGCGCGGGCCGGGGGCGGAAGG - Exonic
1132808507 16:1786796-1786818 CCCCGCATGCTCGGGGCGCAGGG + Exonic
1132828930 16:1918270-1918292 CCGGGGGCGGCCAGGGCGCAGGG - Exonic
1132842368 16:1984316-1984338 ACGCGCGGGGCCGGGGCGCGGGG + Exonic
1133038280 16:3046571-3046593 CCGCTCGCGCCCGGAGAGGAGGG + Intergenic
1133097685 16:3458321-3458343 GCGCCCGCGCCCCCGGCGCACGG + Intronic
1133227862 16:4351116-4351138 CCGGGCACGCAGGGGGCGCACGG + Intronic
1133259424 16:4538559-4538581 CCGCCCCCGCCCGCGGCGCCTGG - Intronic
1133272032 16:4614978-4615000 CCCCGCTCCCCCGGGGCGCCCGG - Intronic
1136365122 16:29806260-29806282 CTGCGCGCGCACCGGGCGCGCGG - Intronic
1138514567 16:57528989-57529011 CAGCGCGGGCGCGGGGGGCAGGG + Exonic
1139496939 16:67326774-67326796 CGGCGCGCGCGCGGGGGGCGGGG + Intergenic
1141526928 16:84617789-84617811 CCGCGCGAGCCCGGGGAGCGGGG + Intronic
1141972341 16:87492450-87492472 GCGGGCGCGCGCGGGGCGCCGGG + Intergenic
1143487442 17:7262527-7262549 TCCCGCGCTCCCGGGGCGCGCGG - Intronic
1144847054 17:18225571-18225593 GCGCCCGCGCCCGGGCCGCCTGG + Exonic
1147429624 17:40363417-40363439 GCGCGCGCGGCGGGCGCGCAGGG + Exonic
1147429625 17:40363424-40363446 CGGCGGGCGCGCAGGGCGCACGG + Exonic
1147879762 17:43646108-43646130 CGGGGCGCGCCCGGGGAGCAGGG + Intronic
1148013358 17:44503461-44503483 CTGCGCGCGCCCGGTGGGCGTGG - Intergenic
1148106439 17:45121292-45121314 CCGCTCGCGCACGTGGCACAAGG - Exonic
1148156823 17:45429547-45429569 CCGCACGGAGCCGGGGCGCAAGG - Intronic
1148337533 17:46851637-46851659 CAGCGCGGGCGGGGGGCGCATGG - Exonic
1148852348 17:50561257-50561279 CCGCGGGGCGCCGGGGCGCAGGG - Intronic
1150124681 17:62628279-62628301 CAGGGCGCGCCCGGGGAGCCAGG + Intronic
1150692647 17:67378521-67378543 CAGCGCGCGCCGGGGGCTCTTGG - Intronic
1152245560 17:79183077-79183099 CCGCGCTCGGCCGCCGCGCAGGG + Intronic
1152594678 17:81232436-81232458 ACTCTCGGGCCCGGGGCGCATGG + Intronic
1152758678 17:82097621-82097643 CAGCCCCCGCCCGGGGCGAAGGG - Intronic
1153900615 18:9614504-9614526 CCGCGGCCGCCCGGGGAGCCGGG + Exonic
1154360310 18:13655307-13655329 CCACGCGGGCCCGGGGGCCAGGG + Intergenic
1156448495 18:37253740-37253762 CCGGGGGCGGCCGGGGCGCGGGG - Intronic
1157515076 18:48305063-48305085 CCCCGCGCACCTGGGGAGCAGGG - Intronic
1157529528 18:48409489-48409511 CGGCGCGGGCGCGGGGCGCGGGG - Intronic
1157610096 18:48950605-48950627 CCGCGCGCGCCCCGGCCTCCGGG - Exonic
1158643180 18:59220313-59220335 CCGCTCGCCCCCGGGGCGCCAGG - Exonic
1160499738 18:79395803-79395825 CCGCGCGGGCCCGGGCAGCAGGG + Intergenic
1160577243 18:79863680-79863702 CCGCCGCCGCCCGGGGAGCAGGG - Exonic
1160745614 19:709597-709619 GCGCGCGCGTCCAGGGCGCCAGG - Intronic
1160909220 19:1467206-1467228 CCGAGCGCGGCGGGGGCGCCGGG + Exonic
1162312065 19:9913699-9913721 CCACGCCCCCCCGGGGCGCCTGG - Intronic
1162731747 19:12722379-12722401 CCGCGCGCGGCCCGGGCGTCGGG - Intronic
1162753232 19:12841308-12841330 GCGCGTGCGCCCTGGGCGCGGGG + Intronic
1162932041 19:13962259-13962281 CTGCGCCGGCCCGGGGCTCAGGG + Exonic
1163695623 19:18761910-18761932 CCCCGCGGGCCCAGGGCCCAGGG - Intronic
1165305484 19:35000444-35000466 GTGGGCGCGCCCCGGGCGCAGGG - Exonic
1165851452 19:38852218-38852240 CCGCGCGCGGCCGGGGGCCAGGG - Intronic
1166706105 19:44908881-44908903 CCGCGAGCGCCTGGGGCCCCTGG + Exonic
1167134522 19:47608976-47608998 GGGCGCGGGCCCGGGGCGCGCGG + Intronic
1167437455 19:49487654-49487676 CCGCGCGGGCCGGGGCGGCAAGG + Intronic
1168307191 19:55442209-55442231 CCCGGTGCGCCCGGGGCGCACGG + Exonic
927053742 2:19352126-19352148 CCGCGTGCGCCAGGGACCCAGGG + Exonic
927168737 2:20350848-20350870 CTGCGCGCGCCCGGTGGGCGGGG - Intronic
929151145 2:38750506-38750528 CCGCGCGCTCCCGGTGCGCCCGG - Intronic
930046291 2:47175966-47175988 CCTCCCGCCCCCTGGGCGCATGG + Intronic
930711920 2:54557999-54558021 CCGCGCGGGCCCGGGACCCTTGG + Intronic
933772822 2:85754729-85754751 CGGGGCGCGTCGGGGGCGCAGGG - Exonic
934566852 2:95346236-95346258 CCGCGCGGGCCAGCGGCGCGGGG + Intronic
934670326 2:96208455-96208477 CCGCGAGCTTCCGGGGCCCAAGG + Exonic
935301723 2:101698329-101698351 CCGCGCGACCCCCGGGCGCTGGG + Intronic
936433291 2:112482315-112482337 CGCCGCGCGCCCGGGCCGCCGGG - Exonic
938448398 2:131394716-131394738 CTGCGGGCGCCCGCGGAGCAGGG - Intergenic
939629675 2:144516935-144516957 CCGCTCGCGCCCGGCCCGCCGGG - Intronic
942653706 2:178194265-178194287 CCCCGCGTGACCAGGGCGCAGGG + Intergenic
944114245 2:196170958-196170980 CCGCGCGGGCCCGCCGCGAAGGG + Intronic
946966422 2:225042201-225042223 CCCCGGGCGCCTGGGGCGCGCGG + Intronic
949045194 2:241869701-241869723 CTGCGCCCGCCGGGGGCCCAAGG - Intronic
949079898 2:242088521-242088543 CCGCGCGCGCCCAGAGTGCCGGG - Intergenic
1169673835 20:8132612-8132634 CCGCGCTCGCCCGGGCCGCCCGG + Exonic
1174287748 20:49484125-49484147 CGGCGGGCGCCGGGGGCGCGGGG + Intergenic
1175215903 20:57391600-57391622 AAGCCCGCGCTCGGGGCGCACGG - Exonic
1175399527 20:58692720-58692742 CAGGGCCCGCCCGGGGCGCGAGG - Exonic
1175429600 20:58891944-58891966 GAGCGCGCGCCCGGGGCGGGGGG - Intronic
1176550434 21:8218679-8218701 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1176569363 21:8401718-8401740 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1176577276 21:8445949-8445971 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1178673788 21:34614550-34614572 CCGCGCGCCCCGGGGGTGCTAGG + Intronic
1180960102 22:19758680-19758702 CTGCGCCCGGCCGGTGCGCAGGG + Intronic
1181831609 22:25564784-25564806 GCGCGCGTGCGCGGGGCGCCGGG + Intergenic
1183715084 22:39528783-39528805 CCGCCTGCGCCCGGGGAGCGTGG - Intergenic
1184663452 22:45976056-45976078 CCCCGCCCGCCCGGGGCCCTGGG - Intronic
1184711218 22:46250493-46250515 CCGCGCGCTCCCGCAGCGCACGG - Exonic
1185278630 22:49960667-49960689 CCTCGCGGGCCCCGGGCGGAAGG + Exonic
1203255330 22_KI270733v1_random:135018-135040 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
949710147 3:6862488-6862510 CCGCGAGAGCCCAGGGCGCGAGG + Intronic
954076866 3:48188032-48188054 CCGCGGGCGCCGGTGGCGCGCGG - Exonic
964282327 3:155080044-155080066 GCGCGAGCGCCCAGGGCGCTGGG + Intronic
967858501 3:194135018-194135040 GTGCGCGCGCCCCGGGGGCAGGG - Intergenic
968405413 4:336512-336534 CTGCCCGCGCCCGGAGCGGATGG + Intergenic
968433894 4:575470-575492 CTGCGAGCGCGCGGGGCGCCGGG + Intergenic
968505046 4:967666-967688 CCCCGGGCGCCCGGGACTCACGG - Intronic
968556545 4:1248836-1248858 CCGCGCGGGCGGGGGGCGCGGGG - Intronic
969405288 4:6987378-6987400 CCGGGCAGGCCTGGGGCGCAGGG - Intronic
972671000 4:41214152-41214174 CGGCGCGGGCGCAGGGCGCACGG + Intronic
973931067 4:55793688-55793710 CCGCGCCCGCCCGGGGCGAGGGG - Intergenic
976704716 4:88008122-88008144 CCGCGCGCCCACGGAGCTCACGG - Exonic
983254141 4:165379302-165379324 CCGCGGGCGCCCCGGGCTCCTGG - Exonic
983577033 4:169271088-169271110 CAGCCGGCGCCCGGGGCGCAAGG + Exonic
985068403 4:186144876-186144898 CCGGGCGCGCCCGGGGTCCGCGG - Exonic
985129659 4:186726766-186726788 CCGTCCGCGCCCGGGGCGGGGGG - Intergenic
985595165 5:784699-784721 TCGCGCGCGGCCGGGTCGCGGGG - Intergenic
986184508 5:5423011-5423033 CCCCCCGCGCCCGGGGCCCCGGG - Intronic
986748040 5:10761180-10761202 ACGCGCGCGCGTGGGGCGCCGGG + Exonic
991298177 5:65103059-65103081 CCGCTCGGGCCCGGGGCGACCGG - Intergenic
992320796 5:75611645-75611667 CCGGGCGCGCCCGGGGCCAAGGG + Exonic
992460232 5:76953715-76953737 TCGCGGGCGCCCGGGACGCGGGG + Intronic
1002000598 5:176194558-176194580 CTGCGCGACCCCGGTGCGCAGGG - Intergenic
1002046243 5:176543216-176543238 CGCCGAGCGCCCCGGGCGCAGGG - Intronic
1002140227 5:177133518-177133540 CCGCTCGCGGCCGGGGCCTACGG - Intronic
1002253741 5:177944423-177944445 CTGCGCGACCCCGGTGCGCAGGG + Intergenic
1002645041 5:180648923-180648945 CACCGCGCGCCCGAGGCGGACGG - Intronic
1004228992 6:13814248-13814270 CCGCGGGCCGCCGGGGCGCGAGG + Exonic
1008673234 6:53794595-53794617 CCTTGCGCGCCGGGGGCGCCAGG - Intronic
1008673235 6:53794595-53794617 CCTGGCGCCCCCGGCGCGCAAGG + Intronic
1010926726 6:81753333-81753355 CCGCGCACGCCCGAGGCCCGTGG - Intergenic
1011054663 6:83192998-83193020 CAGCCCGCCCGCGGGGCGCAGGG + Intronic
1012625029 6:101393981-101394003 CAGCGGGCGCCCCGAGCGCACGG - Intergenic
1013170747 6:107634735-107634757 CCGCCCGCGCCCGGGGGGCCCGG - Exonic
1017662412 6:156687386-156687408 CCGCGCGGAGTCGGGGCGCAGGG + Intergenic
1017696586 6:157021718-157021740 CTGCGGGCGCGCGGGGCGGACGG - Intronic
1019298080 7:289678-289700 TCAGGCGCGCCCAGGGCGCACGG + Intergenic
1019554102 7:1620012-1620034 CCGCCCCCGCCCGGGCCTCAGGG + Intergenic
1019765106 7:2844186-2844208 CCGCCGGCGCCCGGGGGCCATGG + Exonic
1022098719 7:27156798-27156820 CCGCCCGCGCCCGGCGGGCCTGG + Intronic
1024043833 7:45574484-45574506 CCTCGCCGGCCCGGGGCGCCGGG - Intronic
1027319787 7:77004318-77004340 CCGTCCACCCCCGGGGCGCATGG - Intergenic
1029270689 7:99375096-99375118 CCGAGGGCGCCCGGTGCGCTGGG - Intronic
1029536997 7:101162952-101162974 GCGCGCGCGGCGGGGGCGCGCGG + Exonic
1030093386 7:105876865-105876887 CCGCCCAAGCCTGGGGCGCAGGG + Intronic
1034426936 7:151018899-151018921 CCGCGCGCCCCCAGCGCGCCAGG + Exonic
1034446288 7:151115723-151115745 CCGCGCGCGTCCGGGGCTGGCGG + Intronic
1034977942 7:155458777-155458799 CCGCCCGCGCCGGGCGCACATGG - Exonic
1034979816 7:155468373-155468395 CAGCGCGCGCCCGGACCGCGCGG - Intergenic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1045488652 8:102654272-102654294 CCCCGCGGGCCCGGCGCGCACGG - Intronic
1047961767 8:130016369-130016391 CCTCGCCCGCCCGGGCCGCCAGG - Intronic
1048484295 8:134832519-134832541 GCGCGCGCGCCCAGAGCGCTGGG + Intergenic
1048553977 8:135457618-135457640 CGGCCCGCGCCCGGAGCGCGGGG + Exonic
1049191805 8:141292447-141292469 CCGCACGCGCCCAGGGCGGGAGG + Intronic
1051079613 9:13279336-13279358 CGGCGCGCGCGCAGGGCGCGGGG + Intronic
1051174015 9:14346121-14346143 CCGCGGGCGCGGGGGGCGCGTGG + Intronic
1052809468 9:33044467-33044489 CCGCGCACGCGCAGGGCGGACGG - Exonic
1053022045 9:34701638-34701660 CCGCGCGCGGGCCGGGCGTATGG + Intergenic
1056532472 9:87498771-87498793 CCACGCGCGCGCGGGGCTGAGGG + Intronic
1056738784 9:89234769-89234791 CGGCGGACGCCCAGGGCGCACGG + Intergenic
1060811206 9:126612506-126612528 CCGCGGGGCCCCGCGGCGCAGGG + Intergenic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061961770 9:133992348-133992370 CCGCGCGCGCGCGGGGCTCAGGG + Intronic
1062230635 9:135479889-135479911 CCGCCCTCGGCCGGGGCGCGGGG - Exonic
1062325041 9:136008841-136008863 CCTGGCCCGCCCGGGGCGCAGGG + Exonic
1062537735 9:137028232-137028254 CCGCGCGGGGGCGGGGCGCTCGG + Intronic
1062579175 9:137221998-137222020 CGGCGCGCGGCCGGGACGCCAGG - Intergenic
1062584176 9:137241580-137241602 CCCCGCGCGCCCTGGCCGCCGGG - Intronic
1203471728 Un_GL000220v1:118155-118177 TCCCGCGCGCGCGGGGCGCGTGG - Intergenic
1186466310 X:9786563-9786585 CCGCGCGCGGCCCGAGCGCCTGG + Exonic
1187172997 X:16869997-16870019 CGGCGCGCGCCGGGGCCGCGGGG - Intronic
1189331011 X:40145277-40145299 CCGCGCGAACCCGCGGCGCCCGG + Intronic
1189336274 X:40172567-40172589 GCGCGCGCGCCCTGGCCGGACGG + Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1199772741 X:150984408-150984430 CCGCGCGCGGCCGGCGCGGGCGG - Intronic