ID: 1060959697

View in Genome Browser
Species Human (GRCh38)
Location 9:127671320-127671342
Sequence GCATCTGCCTAGTCTGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060959697_1060959706 21 Left 1060959697 9:127671320-127671342 CCCTACCCAGACTAGGCAGATGC 0: 1
1: 1
2: 1
3: 24
4: 111
Right 1060959706 9:127671364-127671386 TACCTGGTGAGTCCCCTCGAAGG No data
1060959697_1060959707 22 Left 1060959697 9:127671320-127671342 CCCTACCCAGACTAGGCAGATGC 0: 1
1: 1
2: 1
3: 24
4: 111
Right 1060959707 9:127671365-127671387 ACCTGGTGAGTCCCCTCGAAGGG No data
1060959697_1060959703 5 Left 1060959697 9:127671320-127671342 CCCTACCCAGACTAGGCAGATGC 0: 1
1: 1
2: 1
3: 24
4: 111
Right 1060959703 9:127671348-127671370 CCACGTGCACCCACACTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060959697 Original CRISPR GCATCTGCCTAGTCTGGGTA GGG (reversed) Intronic
900394959 1:2449608-2449630 GCCTCTGCCTGGCCTGGGTGGGG + Intronic
900714870 1:4137865-4137887 GCATCTGCCAGGTCTGGGGAGGG + Intergenic
903831111 1:26175609-26175631 GAATCTGCCTGTTCTGAGTAGGG + Intergenic
906940161 1:50248855-50248877 GCACATGCCTAGCCTGTGTAAGG - Intergenic
908046295 1:60173066-60173088 GCATCTGCATTGTTTGGGCATGG - Intergenic
908475398 1:64482897-64482919 TCATCTGCGTAGTCCTGGTATGG + Intronic
912493804 1:110078385-110078407 GGATCCACCTAGTCTGTGTATGG - Intergenic
912502476 1:110131253-110131275 GCAGCTGCCTGGATTGGGTAAGG - Intergenic
913106429 1:115617825-115617847 CCATCTGCTTAGTGTGGGTCTGG - Intergenic
915510758 1:156385790-156385812 GCATCTTCCTCTTCTGGGTTTGG - Intergenic
919297505 1:195721429-195721451 GTATCTGCCTTATCTGGGTATGG - Intergenic
921073831 1:211684120-211684142 GCATCTGCTTAGTGTGAGGAGGG + Intergenic
923397236 1:233578877-233578899 GCATTTGCCAAGTCTGGGCCTGG - Intergenic
1062780326 10:199103-199125 GCATCTGCCAATTCTGGAAAAGG - Intronic
1064834354 10:19509321-19509343 GCATCTGCCTCATTTGGGTATGG + Intronic
1065961177 10:30735498-30735520 AAATCTGCCTAGGCTGGGCATGG + Intergenic
1068606177 10:59007713-59007735 CCATGTGCCTAGTATGGGTATGG - Intergenic
1069899533 10:71699476-71699498 GCATCTGCATGCACTGGGTATGG + Intronic
1070492019 10:76986335-76986357 CCATCTGTCTAAGCTGGGTAAGG + Intronic
1071059007 10:81548190-81548212 GAATCTGCGTATTCTGGGTTTGG - Intergenic
1072346247 10:94509654-94509676 GTATCTGCCAGGTCTAGGTATGG - Intronic
1073075678 10:100824765-100824787 GCAGCTGCCTAATCTAGGTGGGG + Intronic
1083847548 11:65344906-65344928 CCAGCTGCCTGGTCTGGGGAGGG - Intronic
1086312579 11:85550701-85550723 GCAACTGGCTAGTTTGGGTACGG + Intronic
1088834162 11:113563244-113563266 GCATTTGCCTTACCTGGGTATGG - Intergenic
1089385541 11:118065126-118065148 GCAGCTGCCTAGGCTGGGGAGGG - Intergenic
1090563938 11:127965442-127965464 GCCTCTGCCTACACTGTGTAGGG + Intergenic
1092024719 12:5231113-5231135 GCATCTGCATAGCCTGGGAAGGG - Intergenic
1092026529 12:5245453-5245475 GCTTCTGCCAAGTGTGGGTGGGG - Intergenic
1094324040 12:29217249-29217271 GCATCTGCTCAGTCCGGGTATGG + Intronic
1095431865 12:42143549-42143571 GCATTTGCCAAGTCTTGGTAGGG + Intronic
1097240604 12:57572512-57572534 GCCTCTGCCTGGGCTGGGCAAGG + Intronic
1097911014 12:64969216-64969238 GCAGCTTCCTGGTCTGGTTATGG + Intergenic
1099769471 12:87032847-87032869 ACATATGCTTATTCTGGGTATGG - Intergenic
1101511452 12:105396688-105396710 GCATTTGCCCACTATGGGTATGG + Intergenic
1102178601 12:110894661-110894683 GCATCTGCCCAGCTTGGGGAGGG - Intronic
1103498923 12:121385305-121385327 ACATGTGCCTAGGCTGGGCACGG - Intronic
1103538139 12:121647662-121647684 GCAGCTTCATAGTCTGGGTGGGG + Intergenic
1103618008 12:122167318-122167340 ACATGTGCCCACTCTGGGTAAGG - Intergenic
1105592025 13:21801074-21801096 GCATCTGCCTTATATGGGCATGG - Intergenic
1108147203 13:47491095-47491117 GCATCTTCATTGCCTGGGTAGGG + Intergenic
1118418339 14:65570277-65570299 GCATTTGCTGATTCTGGGTAGGG - Intronic
1119404406 14:74388583-74388605 ACATCTGGCTAGGCTGGGCACGG + Intergenic
1119472248 14:74907387-74907409 GCAGCTGCCTAGCCTGAGGAAGG - Intronic
1121563791 14:94893835-94893857 GCATCCGCAATGTCTGGGTACGG + Intergenic
1121649685 14:95548776-95548798 GCCTCTGCCCAGCCTGGGTCTGG - Intergenic
1124065850 15:26342971-26342993 GCATTTGCCTTATCTGGGTGTGG + Intergenic
1124065856 15:26343002-26343024 GCATCTGCCCTGTCTGGGTGTGG + Intergenic
1124065859 15:26343033-26343055 GCATCTACCTTGTCTGAGTGTGG + Intergenic
1128758828 15:70201085-70201107 GCATCTGCCGAGCCTGGGCCTGG + Intergenic
1129919813 15:79310911-79310933 GCTTCTCCCTCTTCTGGGTAGGG + Intergenic
1132454340 16:14335-14357 GCAACGGCCAAGTCTGGGTCTGG + Exonic
1137710981 16:50566678-50566700 GCAGCTGGCAAGGCTGGGTAAGG + Intronic
1137984227 16:53094253-53094275 GCATCCGCCTAGTCTGGGCTGGG + Intronic
1139366587 16:66437449-66437471 GCACGTGCCTAGTCTGGGCAAGG - Intronic
1139436469 16:66939497-66939519 CCAGCTGCCCAGTCTGGGTAAGG - Intronic
1140922306 16:79550700-79550722 GAATTTGCCTAGTTTGGGTATGG + Intergenic
1141901063 16:86990875-86990897 TCATCTGCCTACTTTGGGAAGGG + Intergenic
1143477516 17:7211283-7211305 GCATCTGAGTTGTCTGGGTTAGG - Intronic
1144293949 17:13855362-13855384 GCAAATGCCTGGCCTGGGTAGGG - Intergenic
1147043037 17:37732432-37732454 GCATCTCATTAGTCGGGGTATGG + Intronic
1151916350 17:77121015-77121037 GCAGCTGCCTAATCCGGGTGAGG + Intronic
1155734253 18:29201434-29201456 GCATTTGCTTATTCTGCGTATGG - Intergenic
1160849198 19:1181970-1181992 GCAGCAGCCTAGTCTGGGTCAGG + Intronic
1163286425 19:16351245-16351267 TCACCTGCCTCTTCTGGGTACGG + Intergenic
1164865434 19:31600711-31600733 GCATCTTCCCAGCCTGGGTCAGG + Intergenic
1165203414 19:34163761-34163783 GCATTTGCCAAGTCTGGGCATGG + Intergenic
1165255628 19:34576082-34576104 GCAGCTACCTAGTTTGGGGATGG + Intergenic
1167295522 19:48646769-48646791 ACATCTGCGTAGGCTGGGGAGGG + Intergenic
1168333538 19:55583764-55583786 GCATGCTCCTAGTCTGGGCACGG - Intergenic
926135410 2:10332467-10332489 GCTTCTGCCTAGGGTGGGCAAGG + Intronic
927168851 2:20351338-20351360 GCATCTCCCTCGTCTGGTTGTGG - Intronic
929997976 2:46840914-46840936 GAATGTGACTAGTCTGGGTCAGG - Intronic
934729806 2:96649455-96649477 GCATCTGCACAGTCTGGGTGAGG - Intergenic
938622375 2:133069553-133069575 GCATCTGTCTATACTGGGGATGG - Intronic
939639422 2:144621308-144621330 ACATCTGACTAGTCTAGCTAGGG + Intergenic
943743265 2:191434246-191434268 GCGTCTGCCTTATCTGGGCATGG + Intergenic
944033311 2:195263753-195263775 GCATCTGTCTAGTGTAGGGAGGG - Intergenic
948392786 2:237624934-237624956 GCCTCTACCTTGTCAGGGTAGGG - Intergenic
1170333689 20:15244462-15244484 TCAGCTGCCTAGTTTGGGTCTGG + Intronic
1175705877 20:61176177-61176199 GCATCTCCCTAGACTGGGAATGG - Intergenic
1176250193 20:64116923-64116945 GTCCCTGCCTAGTCTGGGTGAGG + Intergenic
1176424939 21:6542778-6542800 GCAGCTGCCTAGAATAGGTAGGG - Intergenic
1179465873 21:41572283-41572305 GCATCTGCCTTATGTGGGCATGG + Intergenic
1179700428 21:43151087-43151109 GCAGCTGCCTAGAATAGGTAGGG - Intergenic
1181046228 22:20215641-20215663 GCATCTGCCCAGGCAGGGGAGGG - Intergenic
951144006 3:19204754-19204776 GCAACTCCCCAGTCAGGGTATGG + Intronic
953781471 3:45874858-45874880 CCAGCTGGCTAGTCTGGGTTTGG - Intronic
953977924 3:47396281-47396303 GAAACTGCCTAGGCTGGGCATGG + Intronic
954195876 3:48996944-48996966 GCAGCTGTCTATGCTGGGTAGGG - Intronic
956186705 3:66569635-66569657 GCATCTGCCTGGTCTGGGCCAGG + Intergenic
957828028 3:85475296-85475318 GCATCTGGCTAGTGTGGGCCTGG + Intronic
959266783 3:104150953-104150975 GCATCTGCCTTATTTGGGCATGG + Intergenic
962274475 3:134001626-134001648 ACATCTGCAGGGTCTGGGTAAGG + Intronic
968767813 4:2483190-2483212 ACAGGTGCCTAGTCTGGGTAAGG - Intronic
971353690 4:25875305-25875327 GCATCTGCCAAATCAGGGGAAGG + Intronic
979150709 4:117310906-117310928 GGGTCTGCCTAGTCTGGCTTTGG - Intergenic
981535542 4:145795807-145795829 GTATCTGCCTAGCCAGAGTAGGG + Intronic
982540219 4:156659671-156659693 GCATCTGTCTTATCTGGGCATGG + Intergenic
989598873 5:43183332-43183354 GCATCTGCGTAGGCTGGGAGTGG + Intronic
992143122 5:73819381-73819403 TGATCAGCCTAGTCTGGGTGGGG - Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
997402544 5:133613319-133613341 CCATCAGCCTGGCCTGGGTAGGG - Intergenic
997981489 5:138470254-138470276 GCATCTGCCTACTCTGTGAGAGG + Intergenic
1002291983 5:178206247-178206269 TTATGTGCCTATTCTGGGTACGG + Intronic
1002310151 5:178309283-178309305 GCAGCTGCCCAGGCAGGGTAGGG + Intronic
1002314274 5:178333307-178333329 GCACCTTCCAAGTCTGGGTTTGG + Intronic
1006827233 6:36944464-36944486 GCACCTGCCTAGTGGGCGTAAGG + Intergenic
1008311970 6:49987948-49987970 GCATCTGCCTTATTTGGGCATGG - Intergenic
1021015882 7:15532698-15532720 ACATCTTCCTAGGCTGGGTGCGG + Intronic
1023957449 7:44898248-44898270 GCATCTGCCTTATTTGGGCATGG - Intergenic
1029160671 7:98549283-98549305 ACATCTGCCGAGTCTGGGGAGGG + Intergenic
1033039747 7:137907167-137907189 GCCACTGCCTAGTGTGGGTAAGG + Intronic
1036138921 8:6188464-6188486 GCATCTGCCTCATCTGGGCAAGG - Intergenic
1037657585 8:20898721-20898743 TCATCTGCCAAGTCTGGGTATGG + Intergenic
1037754494 8:21702343-21702365 GCATGTGCCTGTTCTGGTTATGG - Intronic
1044358090 8:91248923-91248945 GCTACTGCCCAGTCTGGGAAAGG - Intronic
1046488943 8:114922050-114922072 GCATCTGCCTTATTTGGGCATGG - Intergenic
1047706821 8:127507451-127507473 GCATCGGCCTACTCTAGGTCAGG + Intergenic
1048759130 8:137771846-137771868 TCATCTGCCTTGTTTGGTTAAGG + Intergenic
1048954677 8:139526021-139526043 GCATCTCCCTAGACTGAGGAAGG - Intergenic
1049391478 8:142373775-142373797 GCCTCTGCCTGGAGTGGGTAAGG - Intronic
1056712510 9:89002141-89002163 GCAACTGCCTGGTCAGGGGACGG + Exonic
1058373162 9:104293492-104293514 TCATTTTCCTGGTCTGGGTAGGG - Intergenic
1060959697 9:127671320-127671342 GCATCTGCCTAGTCTGGGTAGGG - Intronic
1061169139 9:128941848-128941870 GCAGCAGCCTAGGCTGGGTCAGG + Exonic
1192168886 X:68842450-68842472 GCATCTGCCCAGTCTGGCACAGG + Intergenic
1195630359 X:107049430-107049452 GCATCTGCCAAGTCTGGGTATGG - Intergenic
1196506923 X:116457663-116457685 GCAACTCCCCAGTCAGGGTATGG - Exonic
1196522402 X:116688910-116688932 GCAACTCCCCAGTCAGGGTATGG - Intergenic
1200986946 Y:9311234-9311256 GAATCTGCCTTCTCTGGGTAGGG - Intergenic
1202118676 Y:21501842-21501864 GAATCCGCCTTCTCTGGGTAGGG + Intergenic
1202121128 Y:21525382-21525404 GAATCCGCCTTCTCTGGGTAGGG + Exonic
1202123579 Y:21548922-21548944 GAATCCGCCTTCTCTGGGTAGGG + Exonic
1202155428 Y:21880458-21880480 GAATCCGCCTTCTCTGGGTAGGG - Exonic
1202157876 Y:21904000-21904022 GAATCCGCCTTCTCTGGGTAGGG - Exonic
1202184324 Y:22168924-22168946 GAATCCGCCTTCTCTGGGTAGGG - Exonic
1202207035 Y:22417477-22417499 GAATCCGCCTTCTCTGGGTAGGG + Exonic