ID: 1060960298

View in Genome Browser
Species Human (GRCh38)
Location 9:127676066-127676088
Sequence CCTAGGGGCCCTTTTTGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060960298 Original CRISPR CCTAGGGGCCCTTTTTGTTT GGG Intronic
900040303 1:456430-456452 CCTAGGAGCAATTTTTTTTTTGG - Intergenic
904049548 1:27631047-27631069 CCTGGGGGCCATTCTGGTTTTGG - Intronic
907761618 1:57367358-57367380 GCTAGGTGCCTTTTTTGTCTGGG + Intronic
913658323 1:120983031-120983053 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914009685 1:143766118-143766140 GATAGGGGCCCTTTCTATTTTGG + Intergenic
914648305 1:149674792-149674814 GATAGGGGCCCTTTCTATTTTGG + Intergenic
918210882 1:182349811-182349833 CCTTTGGTTCCTTTTTGTTTGGG + Intergenic
920450323 1:206055968-206055990 CATAGGGGGACTTTATGTTTAGG - Intronic
920906427 1:210174238-210174260 CCTAGGGGCAGTTTTTTGTTTGG - Intergenic
1064258064 10:13762001-13762023 TCTAGGGTCAGTTTTTGTTTTGG + Intronic
1070321862 10:75360424-75360446 CCTGGGGGCCCTTGTTTTTCAGG + Intergenic
1071335219 10:84594848-84594870 CCTTGGGGCACTTTATGTGTGGG + Intergenic
1074393680 10:113079171-113079193 CCTGGGGAGCCTTTTGGTTTTGG + Intronic
1074521091 10:114224816-114224838 CCTAAGGTCCTGTTTTGTTTTGG + Intronic
1075155093 10:119969133-119969155 AGTAGGGGCCATGTTTGTTTTGG + Intergenic
1075324671 10:121521508-121521530 CCTAGTGGCCATTTGTGTCTTGG - Intronic
1075442130 10:122488265-122488287 CCAAGGGTCCCTTTTTGATGTGG - Intronic
1075664664 10:124221913-124221935 CCCAGGGGCCCCTTGTGTTTTGG - Intergenic
1076643834 10:131937621-131937643 CCTAGGGACCATTCTTGTTCTGG + Intronic
1077509658 11:2950872-2950894 CTTTGGGGCTCTTTTTGTTAAGG - Intronic
1080141724 11:28929073-28929095 TTTTGGGGCCATTTTTGTTTTGG + Intergenic
1081675222 11:44964746-44964768 CCTTGAGGCCCTTTTGGTTCAGG - Intergenic
1082167213 11:48963461-48963483 CCTGGGGTCCCTTTTTCTGTGGG - Intergenic
1087684666 11:101249379-101249401 CATGGGGGCACTTTATGTTTAGG - Intergenic
1091267227 11:134280920-134280942 CCTGGGGGCCCTTCTTGCTAAGG + Intronic
1093953194 12:25187721-25187743 CCTTGGGGACCTTTTTGTTTTGG - Intronic
1098426286 12:70367721-70367743 CCTAGTTACCCTTTGTGTTTAGG + Intronic
1100632035 12:96399589-96399611 CCGAGGGGACCTTTGTGTCTCGG + Intronic
1108315048 13:49228578-49228600 CCTTGGGGCCCTCTTTGTGCAGG + Intergenic
1110484054 13:76017221-76017243 CATAGCCGCCCTTTCTGTTTCGG + Intergenic
1112462214 13:99613195-99613217 CCAGGGAGCCCTTTTTCTTTTGG - Intronic
1118711466 14:68523059-68523081 CCCCGGGGACCCTTTTGTTTTGG + Intronic
1119534595 14:75392995-75393017 GTTAGGGGCCTGTTTTGTTTTGG + Intergenic
1119939109 14:78621723-78621745 CCTAGATGCCCTATGTGTTTCGG + Intronic
1120959978 14:90115537-90115559 CCCAGGGGCCCTTTCTGTAAAGG + Intronic
1121464806 14:94108858-94108880 CCAGGGTGGCCTTTTTGTTTTGG + Intronic
1121506447 14:94481425-94481447 CCAAGGTGCCCTTTCTCTTTGGG - Intergenic
1121819280 14:96953272-96953294 CTTCGGGATCCTTTTTGTTTGGG - Intergenic
1123777457 15:23594415-23594437 ATTAGGGGCCCTTTTCTTTTAGG - Intronic
1127603940 15:60567331-60567353 CCTAGGGGCACTAAATGTTTGGG + Intronic
1132347074 15:101114773-101114795 CCTATGGGCCCTCTGTGTCTAGG + Intergenic
1137794645 16:51205361-51205383 CCAAGGAATCCTTTTTGTTTGGG - Intergenic
1144311368 17:14017037-14017059 TCTAAGTGCCCTTTCTGTTTAGG - Intergenic
1146158455 17:30544675-30544697 CCTAAGGGCCCTGGTAGTTTTGG - Intergenic
1146183305 17:30710188-30710210 CCTTGGCGCCCTGTTTGTGTAGG + Intergenic
1148073836 17:44924062-44924084 GCTCTGAGCCCTTTTTGTTTTGG - Intergenic
1151375872 17:73688771-73688793 CCTCGGGGACCTTGTTCTTTAGG + Intergenic
1152387654 17:79984747-79984769 GCTTGGGGCTATTTTTGTTTTGG - Intronic
1154981864 18:21508970-21508992 CCTAGGGGCCCCTCTTGATCTGG - Intronic
1155157391 18:23169065-23169087 TCTAGTGGCCATTTTGGTTTTGG - Intronic
1156887627 18:42153703-42153725 CCAAGAGGCAGTTTTTGTTTTGG + Intergenic
1157001183 18:43527605-43527627 CCTAGAGTCTCTTTTTATTTTGG + Intergenic
1157538880 18:48484828-48484850 CCCAGGGGCTCTTTTTATTTTGG - Intergenic
1164130509 19:22357382-22357404 CATGGGGGGCCTTTATGTTTAGG + Intergenic
1168107532 19:54173744-54173766 CCCAGGGGCCCCTTCCGTTTTGG + Exonic
925318695 2:2944521-2944543 TCTAGGGGTCCCTTTTGTTTAGG - Intergenic
935408416 2:102734357-102734379 CCTTGAGGCCCGTTTTGTTTAGG - Intronic
938624060 2:133089720-133089742 ACCAGGGGCAATTTTTGTTTGGG + Intronic
941436110 2:165475289-165475311 CCTTGGGGCCCTTATTGATTTGG - Intronic
942511428 2:176706648-176706670 AATAGGAGCCATTTTTGTTTGGG - Intergenic
942785527 2:179697139-179697161 CATATGTGCCTTTTTTGTTTTGG + Intronic
942825373 2:180169278-180169300 CCTGTGGCCCCTTTTTTTTTTGG - Intergenic
944258473 2:197649805-197649827 CGTAGGTGCCTTTTTTGTGTGGG - Intronic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1175779077 20:61670898-61670920 CCTAGGGGCCCTTCCTTTTGTGG - Intronic
1184906810 22:47493471-47493493 CCTAGGGGCCCCTGCTGTTTAGG + Intergenic
949679378 3:6495210-6495232 CCTATGGGTCCTGTTGGTTTGGG - Intergenic
951293754 3:20906873-20906895 CAGAAGGGGCCTTTTTGTTTGGG + Intergenic
957022432 3:75140450-75140472 CATGGGGGGCCTTTATGTTTAGG - Intergenic
957187509 3:76961791-76961813 CCTACGGGTCCTTTTTTTATTGG + Intronic
957298533 3:78361945-78361967 CCTATTGGGCCTTTTTGCTTTGG - Intergenic
957999757 3:87736472-87736494 CATAGGGGGACTTTATGTTTAGG + Intergenic
958930797 3:100205763-100205785 GCTAAGGGCCCTTTGTGTATAGG - Intergenic
960838367 3:121930761-121930783 GTTAGGGGCCTTTTATGTTTTGG - Intronic
972768689 4:42175273-42175295 GCTAGGGACCCTCTTTGTGTGGG + Intergenic
977316019 4:95448907-95448929 TCTAGGTGCCCCTTTTCTTTGGG + Intronic
978094441 4:104758375-104758397 CCTCGGGCCCCTATTTGTTTGGG + Intergenic
978308851 4:107363738-107363760 CATAGGGTCCTGTTTTGTTTGGG + Intergenic
981646624 4:147005692-147005714 CCTAGGGGCCATTTTTGGCAGGG + Intergenic
982346645 4:154367399-154367421 CCTGGGGGCCAGATTTGTTTGGG + Intronic
984163895 4:176285514-176285536 ACCAGGAGCCCTTTTTGATTTGG + Intergenic
987197811 5:15544753-15544775 CATTGTGGCCCTTATTGTTTGGG + Intronic
989622258 5:43396280-43396302 CCTTGTGGCCATTTTGGTTTTGG + Intronic
990967654 5:61466446-61466468 CCTGGGGGTTCTTTTTATTTAGG + Intronic
996762906 5:127003934-127003956 GGGAGGGGCCCTGTTTGTTTTGG + Intronic
1000769703 5:165337333-165337355 CCTAGGAGTCCTTATAGTTTTGG - Intergenic
1002733544 5:181362516-181362538 CCTAGGAGCAATTTTTTTTTGGG + Intergenic
1002892779 6:1350529-1350551 CCAAGGGGCTCTGTGTGTTTTGG - Intergenic
1003140842 6:3469897-3469919 TCTAGGGGCCTGTTTTGTTCAGG - Intergenic
1003967146 6:11263717-11263739 CATAGGTGCCATTTTTGTCTGGG + Intronic
1005345748 6:24888510-24888532 CCTAGTGGCTTTTTCTGTTTAGG - Intronic
1005352083 6:24946694-24946716 CCTTGGGCCCCTATTTCTTTTGG - Intronic
1006581338 6:35079399-35079421 CCAGGGGGCCCTCTGTGTTTGGG - Intronic
1015996544 6:139000324-139000346 CCTAAAGGTCCTTGTTGTTTTGG + Intergenic
1017764624 6:157596510-157596532 CATAGGGGCCTTTTTAGTTGAGG + Intronic
1020013852 7:4820102-4820124 CTTAGGAGCCCCTTTTGTTCCGG - Intronic
1021930868 7:25580039-25580061 CCCAGGGGCACTTCTGGTTTTGG - Intergenic
1021950105 7:25766199-25766221 CCTAGGGGTCATTTTAATTTGGG - Intergenic
1025023158 7:55495757-55495779 CCCAGGTGCCCTTTGTATTTCGG + Intronic
1026398890 7:69988888-69988910 CCTAGGAGCACTTTTTGTTGGGG + Intronic
1028239840 7:88406358-88406380 CCTATGGACCTCTTTTGTTTTGG - Intergenic
1028504201 7:91553682-91553704 TCCAGGGTCCCTTTTGGTTTTGG - Intergenic
1032170703 7:129582332-129582354 CATGGGGGGCCTTTATGTTTAGG - Intergenic
1034876699 7:154730734-154730756 TCTAGGGGCCCTTTCTCTTAGGG - Intronic
1035488858 7:159254282-159254304 TCTAGGGTCCCTTTTTAGTTTGG + Intergenic
1037046781 8:14315366-14315388 CCCAGGGGCCATGTCTGTTTTGG - Intronic
1038655559 8:29448008-29448030 TCTAGTGGCCATTTTGGTTTTGG - Intergenic
1038707288 8:29906456-29906478 TCTAGGGGCCCTGTTTGTGATGG - Intergenic
1039107090 8:34001583-34001605 CCCAGGGGCCCCTGTTCTTTTGG - Intergenic
1039278313 8:35955776-35955798 CATGGGGGGCCTTTATGTTTAGG - Intergenic
1041245180 8:55882003-55882025 CCTACTGGCCCTTTCTGTTGTGG + Intronic
1041680871 8:60589611-60589633 TTTATGGCCCCTTTTTGTTTAGG - Intronic
1042339741 8:67666518-67666540 CCAAGGGGAACTTTCTGTTTGGG - Intronic
1042727669 8:71894641-71894663 CCTAGGGGCTCTTTTTGGGTAGG + Intronic
1043232547 8:77821232-77821254 CCCAGTGGGCCTTTTTGATTTGG - Intergenic
1043703567 8:83321800-83321822 CCCAGGGGCCCTGGTGGTTTAGG - Intergenic
1047183078 8:122607384-122607406 CCCAGGGGCCTTTTGTGTATTGG + Intergenic
1048105866 8:131408681-131408703 CCAAGTGTCCATTTTTGTTTTGG + Intergenic
1048212924 8:132471051-132471073 CTTATGGTACCTTTTTGTTTGGG + Intronic
1051444235 9:17123278-17123300 CCTATGTGCCCATTCTGTTTAGG + Intergenic
1052923703 9:33994482-33994504 CCTAACCGCCCTCTTTGTTTAGG - Intronic
1053581762 9:39412233-39412255 CCTAAGGGCCATTTTTGTTAAGG + Intergenic
1053846184 9:42239567-42239589 CCTAAGGGCCATTTTTGTTAAGG + Intergenic
1054103342 9:60970965-60970987 CCTAAGGGCCATTTTTGTTAAGG + Intergenic
1054583013 9:66935872-66935894 CCTAAGGGCCATTTTTGTTAAGG - Intergenic
1055513024 9:77013892-77013914 CCTACGGGCCGTGTCTGTTTAGG - Intergenic
1060405184 9:123369463-123369485 CCTCTGGGCCCTTTGAGTTTGGG + Intronic
1060960298 9:127676066-127676088 CCTAGGGGCCCTTTTTGTTTGGG + Intronic
1061212593 9:129202515-129202537 CCTTGTGGCCCCTGTTGTTTTGG + Intergenic
1061479609 9:130890672-130890694 CCCAGGAGCCTGTTTTGTTTGGG + Intergenic
1203781763 EBV:104901-104923 ACTCGGGGCCCTTTTTGGTTTGG - Intergenic
1186596180 X:10984135-10984157 CCTTGGAGCCTTGTTTGTTTGGG - Intergenic
1186909587 X:14148171-14148193 TCTAGGGTCTCTTTTTGTTTAGG + Intergenic
1187223379 X:17352567-17352589 CCTAGGGGCTTTTTCTGATTTGG - Intergenic
1189479463 X:41381628-41381650 CCTCGTGGCCTTTTTTCTTTAGG + Intergenic
1189783040 X:44534480-44534502 TCAAGGGGCCCTTTCAGTTTGGG - Intronic
1190314891 X:49144305-49144327 GCTAGGGGGCCTTTATGTTTAGG + Intergenic
1195540302 X:106055754-106055776 CCCAGGGGCACTTTTTGGCTGGG - Intergenic
1196869562 X:120099843-120099865 CATGGGGGGCCTTTATGTTTAGG - Intergenic
1198656683 X:138922324-138922346 CCTTGGGGCCATTTTGATTTCGG - Intronic
1198700460 X:139392028-139392050 TCTAGGGGCCCTTTCAGCTTTGG + Intergenic
1198984422 X:142433384-142433406 CCAAGGGTTCCTTTTTGTTGTGG - Intergenic
1200179248 X:154140484-154140506 CCCAGGGGCCCTCTTTCCTTGGG + Intergenic
1200761448 Y:7042824-7042846 CCCAGGGGCCCTTCTGATTTGGG - Intronic
1200948224 Y:8866914-8866936 CATAGGGGGCCTTTATGTTCAGG - Intergenic
1201341078 Y:12935362-12935384 ACCAAGGGCCTTTTTTGTTTTGG - Intergenic