ID: 1060961100

View in Genome Browser
Species Human (GRCh38)
Location 9:127681332-127681354
Sequence AAAACGTTTTTTGCCAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060961098_1060961100 -1 Left 1060961098 9:127681310-127681332 CCCTTCTCATGGCAGCAGAGGTA 0: 1
1: 0
2: 0
3: 15
4: 177
Right 1060961100 9:127681332-127681354 AAAACGTTTTTTGCCAAATATGG No data
1060961099_1060961100 -2 Left 1060961099 9:127681311-127681333 CCTTCTCATGGCAGCAGAGGTAA 0: 1
1: 0
2: 0
3: 18
4: 209
Right 1060961100 9:127681332-127681354 AAAACGTTTTTTGCCAAATATGG No data
1060961094_1060961100 28 Left 1060961094 9:127681281-127681303 CCTGTGGTGGCCTCTGTGTCATT 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1060961100 9:127681332-127681354 AAAACGTTTTTTGCCAAATATGG No data
1060961095_1060961100 18 Left 1060961095 9:127681291-127681313 CCTCTGTGTCATTGTGCAGCCCT 0: 1
1: 0
2: 2
3: 17
4: 176
Right 1060961100 9:127681332-127681354 AAAACGTTTTTTGCCAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060961100 Original CRISPR AAAACGTTTTTTGCCAAATA TGG Intronic
No off target data available for this crispr