ID: 1060961851

View in Genome Browser
Species Human (GRCh38)
Location 9:127686370-127686392
Sequence CTGAATATACAGAATGTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060961851 Original CRISPR CTGAATATACAGAATGTCAG AGG (reversed) Intronic
905217130 1:36416749-36416771 AGGAATATCCAGAATGGCAGAGG - Intronic
906704326 1:47883792-47883814 CTGAATAAAGAGAAAGCCAGTGG - Intronic
907033064 1:51191445-51191467 CTGGAAATATAGAAAGTCAGAGG - Intergenic
907791512 1:57670077-57670099 CTGAATAAAAATAATTTCAGTGG - Intronic
909052075 1:70778152-70778174 CTGAATTTCCAGGATGTAAGTGG + Intergenic
909096986 1:71299853-71299875 CTGAATATACACAATGTTCTAGG + Intergenic
909837120 1:80270193-80270215 CTGAATAAGCTGAATGGCAGAGG + Intergenic
915859041 1:159422547-159422569 CGGTAGGTACAGAATGTCAGTGG + Intergenic
915939386 1:160109297-160109319 CTGAGCATACAGAATGCCACAGG + Intergenic
917546757 1:175977682-175977704 AAGAATATACAGATTGTCTGGGG - Intronic
917786283 1:178461171-178461193 CTGATTATATAGAACTTCAGAGG - Intronic
917883673 1:179363601-179363623 GTGATCATACATAATGTCAGAGG - Intergenic
918112068 1:181464752-181464774 CTGAATAGAAAGAGTTTCAGTGG + Intronic
919191031 1:194219279-194219301 CTGAATAATCAGACTGTCAAAGG + Intergenic
919326979 1:196120463-196120485 CTGAACAAACAGAATGAAAGAGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
921899912 1:220439236-220439258 CTGAATACACAGAACATTAGAGG + Intergenic
922028499 1:221776036-221776058 GTGAATATACAAAATCTCACTGG - Intergenic
922513367 1:226187519-226187541 GTGAATATACATAATGTCGGGGG - Intergenic
923732209 1:236563109-236563131 CTGAATAGAAACAATGACAGAGG + Intronic
923736001 1:236608137-236608159 CTGAATACACTGAATATCCGTGG - Intergenic
1063216159 10:3927447-3927469 CAGAATATTCAGCAAGTCAGTGG + Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1065814826 10:29473990-29474012 CTGCAAACACAGAATGGCAGAGG + Intronic
1066121500 10:32292435-32292457 CTCAATATACAAAATGTTAATGG + Intronic
1066371605 10:34822328-34822350 ATTATTACACAGAATGTCAGGGG - Intergenic
1066494145 10:35925730-35925752 CAAAAGCTACAGAATGTCAGAGG + Intergenic
1068173283 10:53422880-53422902 CTGAATGTCCAAAATGTGAGAGG - Intergenic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1074205699 10:111281010-111281032 TTGAATGTACTGAATGTCTGGGG + Intergenic
1074956278 10:118393186-118393208 GTCAATGTACAGAATGCCAGTGG - Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075199642 10:120391876-120391898 CTGAAAATACACGAAGTCAGAGG - Intergenic
1079886553 11:25997078-25997100 CTGAATAAAGAGAATGTTAGTGG + Intergenic
1080116360 11:28625456-28625478 ATGAGAACACAGAATGTCAGGGG + Intergenic
1080615248 11:33940020-33940042 CTGAATATTCCCAATGTCTGGGG + Intergenic
1080824030 11:35832839-35832861 ATGAATATGCAGAATGTCCTGGG - Intergenic
1082780032 11:57280131-57280153 CTGAATATACTAAATGCCATTGG + Intergenic
1082963958 11:58946905-58946927 CTGAATACACCAAATCTCAGAGG - Intronic
1085012568 11:73151536-73151558 CCCAATATACAGAGTGACAGAGG - Intergenic
1085042035 11:73332100-73332122 ATGAATAACCAGAATCTCAGAGG - Intronic
1085315593 11:75543026-75543048 CAGGATATACAGAGAGTCAGGGG - Intergenic
1087818486 11:102685185-102685207 TTGAGTATAAAGAATCTCAGAGG - Intergenic
1090426826 11:126613203-126613225 GTGAATATACATCATTTCAGGGG + Intronic
1090830072 11:130415068-130415090 CTGGGTACACAGAATGTCGGGGG - Intronic
1091089023 11:132751781-132751803 CTGAATAAACAGCAGTTCAGTGG - Intronic
1092670063 12:10852736-10852758 CTGAAGAGAGAGTATGTCAGAGG - Intronic
1092912822 12:13163348-13163370 CAGAATAAACAGAATAGCAGAGG + Intergenic
1093125635 12:15324685-15324707 CTGAATATAAACTATATCAGAGG + Intronic
1094474732 12:30832501-30832523 CTGAAGACGCAGAATGGCAGAGG + Intergenic
1094652923 12:32395058-32395080 CTGAAAATACACACTGTCACAGG - Intergenic
1094713290 12:32986488-32986510 CTCAATCTCGAGAATGTCAGGGG - Intergenic
1095766502 12:45901331-45901353 CTAAATATACAAAATATTAGCGG - Intronic
1096692039 12:53327365-53327387 CTGTATAGACAAAATGTTAGTGG - Exonic
1098399444 12:70058152-70058174 CTGAAAATACACCATGGCAGAGG - Intergenic
1098855417 12:75647312-75647334 CAGAATATACAGAATATAAAGGG + Intergenic
1101200109 12:102426910-102426932 GTGAATAAAAAGAATGTCAAAGG - Intronic
1101982532 12:109420118-109420140 CTGAATATACAGAAACAGAGTGG - Intronic
1102395579 12:112583052-112583074 CTGAATTGACTGTATGTCAGAGG + Intronic
1102565821 12:113796890-113796912 ATAAATATAAAGTATGTCAGAGG + Intergenic
1102866310 12:116377655-116377677 CAGAATCTGCAGAATGTCACAGG - Intergenic
1103359221 12:120343764-120343786 GTGAATGAACAGAATGTCATGGG + Intronic
1104547828 12:129728187-129728209 CTGAATATAAAGAATGCAATAGG + Intronic
1106048070 13:26164096-26164118 TTGAATATACAGGTTGACAGTGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1109322078 13:60823303-60823325 ATTAATATACAAAATTTCAGGGG - Intergenic
1110075436 13:71235066-71235088 CTGAATGTACTGAATGCCACTGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113373540 13:109743728-109743750 CTGAAAATCCAGAATGGAAGAGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115388279 14:32823329-32823351 CTCAATATTCAGAGTATCAGAGG - Exonic
1115469569 14:33754619-33754641 CTGAATTTCCAGAAAGACAGAGG + Intronic
1116672900 14:47866234-47866256 CTCAATAAAAAAAATGTCAGTGG + Intergenic
1123497382 15:20841865-20841887 CAAAATATACAGTATGTTAGAGG + Intronic
1123554616 15:21415504-21415526 CAAAATATACAGTATGTTAGAGG + Intronic
1123590861 15:21852818-21852840 CAAAATATACAGTATGTTAGAGG + Intergenic
1124859058 15:33420296-33420318 CAGAAGAATCAGAATGTCAGGGG + Intronic
1127551095 15:60039108-60039130 CTGAATGTGCTGAGTGTCAGGGG + Intronic
1130899750 15:88198386-88198408 CTGGGTACTCAGAATGTCAGTGG + Intronic
1131811748 15:96180348-96180370 CTGATTAGAGAGTATGTCAGTGG + Intergenic
1202962959 15_KI270727v1_random:142698-142720 CAAAATATACAGTATGTTAGAGG + Intergenic
1133595120 16:7283555-7283577 ATGGAGATACAGAATGTCAAGGG - Intronic
1134702832 16:16279845-16279867 CTGAATATATGGAATGAAAGAGG + Intronic
1134964711 16:18432270-18432292 CTGAATATATGGAATGAAAGAGG - Intronic
1134968998 16:18514805-18514827 CTGAATATATGGAATGAAAGAGG - Intronic
1135013302 16:18903206-18903228 CTGAAAATAGAGAATATTAGAGG - Intronic
1136330459 16:29572500-29572522 CTGAAAATAGAGAATATTAGAGG - Intergenic
1136445088 16:30312220-30312242 CTGAACATAGAGAATATTAGAGG - Intergenic
1138522767 16:57580796-57580818 TTGAAACTACAGAATGTCAGAGG + Intronic
1139744316 16:69062052-69062074 CTGAAGATAGAGAAAGTCACAGG - Intronic
1141277908 16:82604775-82604797 CTGAAGAGACACAATGGCAGGGG - Intergenic
1144103143 17:11961844-11961866 CTGAAGATAAAGAATGGGAGGGG - Intronic
1150896465 17:69216718-69216740 ATGACTATATAAAATGTCAGTGG + Intronic
1153816768 18:8797491-8797513 CAGAATACACAGAACGCCAGTGG - Intronic
1156640341 18:39087983-39088005 GACAATATATAGAATGTCAGGGG + Intergenic
1158784717 18:60696478-60696500 ATGTAATTACAGAATGTCAGAGG - Intergenic
1158887587 18:61843025-61843047 CTGACTCTACAGAATGGAAGTGG + Intronic
1163042245 19:14611144-14611166 CTAAAAATACAGAACATCAGCGG + Intronic
1163300800 19:16444886-16444908 CTGAAAATACAGAAATTAAGTGG - Intronic
1163920578 19:20284779-20284801 CTGAACATCCAGAATTACAGAGG + Intergenic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
926756189 2:16238014-16238036 ATGAATCAACAGAAAGTCAGTGG - Intergenic
928586525 2:32764247-32764269 CTGAATCTACAGTATCTCTGTGG - Intronic
929378779 2:41324167-41324189 CTAAAAATACAAAATGTTAGCGG + Intergenic
929764761 2:44834918-44834940 CTGAAAATCTAGAGTGTCAGAGG + Intergenic
930463737 2:51717483-51717505 CTGAAGAGCCTGAATGTCAGTGG + Intergenic
932388281 2:71359096-71359118 CTGAATCTACAGTATCTCTGAGG + Intronic
933530741 2:83508118-83508140 TTCAAAATTCAGAATGTCAGTGG - Intergenic
937797303 2:126038943-126038965 ATAAATATATAAAATGTCAGTGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
940524879 2:154800492-154800514 CTGAAAATAAAGAAAGTCACTGG - Intronic
941686901 2:168456575-168456597 ATGAAGATACAGAAGGCCAGGGG - Exonic
941825208 2:169887738-169887760 TTAAAAATAAAGAATGTCAGAGG - Intronic
942864416 2:180655834-180655856 CTGAATAAAATGAATGTCAAGGG - Intergenic
945187695 2:207156373-207156395 CTGTTTATAAAGAATTTCAGAGG - Intronic
945393211 2:209290176-209290198 CAGAATAAATAAAATGTCAGAGG - Intergenic
948561356 2:238855774-238855796 CTGTAAATACAGAATGGCCGAGG + Intronic
1170163413 20:13338545-13338567 CTTATTATACTGTATGTCAGAGG - Intergenic
1173866575 20:46316388-46316410 CAGAATAAATAGAATGTCAGAGG + Intergenic
1176362216 21:6007152-6007174 CTGAGTTTACACAATGTCACTGG - Intergenic
1176985740 21:15433495-15433517 GCGAATATACAGAATGTTAAGGG - Intergenic
1178803290 21:35817151-35817173 CTGAATTTACAGGATGTTTGAGG + Intronic
1179761302 21:43531393-43531415 CTGAGTTTACACAATGTCACTGG + Intronic
1182677613 22:32052147-32052169 CTGAATAACCAGAAGATCAGAGG - Intronic
949359933 3:3220930-3220952 ATAAATATACAACATGTCAGGGG - Intergenic
950271801 3:11622351-11622373 CTGAAATGCCAGAATGTCAGTGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952602309 3:35100226-35100248 CAGAAAATACAGAAAATCAGTGG + Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960579393 3:119262148-119262170 CTGAATCTGCAGTATGTCTGAGG - Intergenic
963565647 3:146926919-146926941 CCAAAGAGACAGAATGTCAGTGG + Intergenic
964156483 3:153591073-153591095 CTGAAAATAAAGCATGCCAGAGG + Intergenic
964610295 3:158607067-158607089 CTAAATATACAAAAATTCAGCGG + Intronic
966942790 3:184757572-184757594 CTGCATATGCACAATGTGAGCGG + Intergenic
968320853 3:197766949-197766971 CTAGAAAGACAGAATGTCAGTGG + Intronic
971295627 4:25387497-25387519 GTGAATATGTAGAATGTTAGAGG + Intronic
971831053 4:31695193-31695215 CAAAATATACAGAATGAAAGTGG - Intergenic
971910706 4:32793421-32793443 ATGAATATAAAGCAAGTCAGTGG - Intergenic
971942334 4:33231493-33231515 TTTAATATACAGAATGGCACTGG - Intergenic
973206019 4:47560962-47560984 CTGAATATGCAGAGTGGCTGAGG + Exonic
974451469 4:62067466-62067488 CTGAATACAGAAAATGTGAGAGG - Intronic
974821360 4:67070594-67070616 GTGAATACACAGAAAGACAGAGG + Intergenic
975299260 4:72770543-72770565 ATGAATATACAGAATGACTCTGG - Intergenic
975410104 4:74038960-74038982 CTGAAGATACAGCCTGTGAGGGG + Intergenic
975441479 4:74415939-74415961 GTCAATATCCAGAATGCCAGTGG - Intergenic
977358015 4:95970832-95970854 CTAATTATACAGAGTTTCAGTGG - Intergenic
978058835 4:104310703-104310725 TTGAGTCTACAGAAAGTCAGAGG - Intergenic
980846242 4:138328861-138328883 TTGAATATCAAGAATTTCAGGGG + Intergenic
981540618 4:145842918-145842940 CTGAAGATACAGAAATTCAGAGG + Intronic
983227905 4:165102061-165102083 CTGATTAAACAGACTGGCAGTGG + Intronic
983409195 4:167375325-167375347 CTGGATATACAGATTTGCAGGGG - Intergenic
983680869 4:170352022-170352044 CTGAATAAAAAGAACTTCAGTGG - Intergenic
983913796 4:173268954-173268976 CTAAATATACAAAAATTCAGTGG - Intronic
984203332 4:176754942-176754964 CTGAAAATACAGATTGTCACAGG + Intronic
984316011 4:178133271-178133293 CTGAATATTCAGTATGTCTTTGG + Intergenic
985718543 5:1476419-1476441 CTGAATCTTCAGGGTGTCAGCGG + Intronic
985910193 5:2873395-2873417 CTGAATATGCATAATGGGAGTGG - Intergenic
986926647 5:12762072-12762094 CTGAATATAAAGGAAGTCAATGG - Intergenic
990350306 5:54909178-54909200 CAAAATACATAGAATGTCAGAGG - Intergenic
991304035 5:65157796-65157818 CTGAATATGTAAAATGTCAAGGG - Intronic
993026275 5:82650663-82650685 CTGAATATATTAAAAGTCAGTGG - Intergenic
993804002 5:92381637-92381659 CAGAGTATACAGAATGTCTCTGG - Intergenic
995040693 5:107584832-107584854 CTCCATATAAAGAATGTAAGAGG + Intronic
995374798 5:111461978-111462000 CTGAAGATCCAGTAGGTCAGGGG - Intronic
996369968 5:122742720-122742742 TAAAATATACAGAATGTTAGTGG - Intergenic
996401396 5:123067119-123067141 GTGAATATACTAAATGTCACTGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998753089 5:145346117-145346139 ATGAATAAACAGAATTTCAAAGG - Intergenic
1000043334 5:157501335-157501357 CTGAACATATATAATGTGAGGGG - Intronic
1000353983 5:160375585-160375607 CTGAATCTTCAGAATATCAAAGG + Intergenic
1000579050 5:163012647-163012669 GCGAATAAACAGAATGTAAGTGG + Intergenic
1004373346 6:15071629-15071651 CTGAAATCACAGAATGTAAGAGG + Intergenic
1005486739 6:26307641-26307663 CAAAATACACAGTATGTCAGAGG + Intergenic
1006723201 6:36173972-36173994 CTGAAGATTCAGAACCTCAGAGG + Intergenic
1006925584 6:37652574-37652596 CAGAATATACACTATGTGAGAGG + Intronic
1006935110 6:37711829-37711851 CTACATTTACTGAATGTCAGAGG + Intergenic
1010622012 6:78088524-78088546 TTCAATATACAAAATGTTAGAGG + Intergenic
1012185804 6:96215183-96215205 CTGAATATACAGATTTTCTCTGG - Exonic
1014979948 6:127933974-127933996 ATGAATATACTGAGTCTCAGAGG + Intergenic
1015710232 6:136131047-136131069 CTGAATATACAGAATGGATATGG - Intronic
1016421464 6:143888460-143888482 CTGAATATATAGAATGTTTTGGG + Intronic
1016959683 6:149660794-149660816 CTGCATATACAGATTGTTATTGG - Exonic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1020470888 7:8533192-8533214 CTGAAAATACATAATGATAGTGG - Intronic
1020535096 7:9387835-9387857 CTGGCTATAAACAATGTCAGTGG + Intergenic
1020960168 7:14792777-14792799 TTGAATAGAAAAAATGTCAGGGG - Intronic
1021081382 7:16369884-16369906 CTAAATGTCCAGAATGTGAGAGG + Intronic
1021932932 7:25599450-25599472 CTAAATTTACAGATTTTCAGAGG - Intergenic
1026341987 7:69442400-69442422 CAGAAAACACAGAATGTCAGTGG - Intergenic
1026746450 7:73016960-73016982 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1026750101 7:73045103-73045125 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1026753749 7:73073213-73073235 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1026757400 7:73101249-73101271 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1027032553 7:74901518-74901540 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1027090004 7:75292237-75292259 CTAAAAATACAAAAAGTCAGCGG - Intergenic
1027093649 7:75320165-75320187 CTAAAAATACAAAAAGTCAGCGG - Intergenic
1027097292 7:75348132-75348154 CTAAAAATACAAAAAGTCAGCGG - Intergenic
1027322055 7:77019540-77019562 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1027325689 7:77047460-77047482 CTAAAAATACAAAAAGTCAGCGG + Intergenic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1028379400 7:90182051-90182073 CTGAATATATACAGTGACAGAGG + Intronic
1029892882 7:103949813-103949835 CTGAGTATAGAGTATGTGAGAGG - Intronic
1030682032 7:112444026-112444048 TTGAACATAAAGAATATCAGTGG - Intronic
1032751367 7:134845179-134845201 CAGAATTTATAGAATGTCATAGG - Intronic
1033858427 7:145594576-145594598 CCCATTATACAGAAGGTCAGCGG + Intergenic
1034605082 7:152305224-152305246 GTGAATATACACTCTGTCAGAGG + Intronic
1036514338 8:9429910-9429932 CTGAGTAGACAGAATTACAGGGG + Intergenic
1036946172 8:13097040-13097062 CTTAGTATATAGAATGTGAGGGG - Intronic
1036992923 8:13619664-13619686 ATGAATATACATTTTGTCAGAGG - Intergenic
1037510778 8:19579675-19579697 CTGAATAAACAGAAAGTTAAAGG + Intronic
1040085461 8:43335430-43335452 CAAAATATACAGTATGTTAGAGG - Intergenic
1040407288 8:47118065-47118087 CAAAATATACAGTATGTTAGAGG + Intergenic
1041141995 8:54830437-54830459 CTAGAAATACAGAAGGTCAGTGG - Intergenic
1041795785 8:61746485-61746507 CTGACTATAAAAAATGTAAGTGG - Intergenic
1042952206 8:74212375-74212397 CTGAATTTATATAATGGCAGTGG - Intergenic
1043005554 8:74814106-74814128 CTGAATCTACAATATCTCAGAGG + Intronic
1044993705 8:97818930-97818952 CTGGATATACAAAATGTCCCTGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1047274801 8:123397534-123397556 CTGAATGATCAGAATGTCCGAGG + Intronic
1047418384 8:124685109-124685131 GTGAATATACTTAATGTCACAGG - Intronic
1047738889 8:127791130-127791152 CTGCATTTACAGAATGGAAGTGG + Intergenic
1050212232 9:3273700-3273722 CTGAAAATACAAAAAGTTAGTGG + Intronic
1052034505 9:23665080-23665102 CTGAATATATATAGTGACAGGGG - Intergenic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1056018047 9:82412174-82412196 CAGAATATATAAAAAGTCAGAGG - Intergenic
1057590537 9:96369480-96369502 CTGAAGATAAACAAAGTCAGAGG + Intronic
1060961851 9:127686370-127686392 CTGAATATACAGAATGTCAGAGG - Intronic
1062392422 9:136339225-136339247 ATGAATGTACAAAATGCCAGTGG + Intronic
1062679909 9:137773756-137773778 CCGAATACGAAGAATGTCAGAGG + Intronic
1185838535 X:3367802-3367824 CTCAATCTCGAGAATGTCAGTGG - Intergenic
1187320908 X:18236904-18236926 CTGAATCTTCAGAATGGAAGTGG + Intergenic
1187577572 X:20574719-20574741 TAAAATATATAGAATGTCAGTGG + Intergenic
1188169371 X:26904374-26904396 ATGAATATAAAGAATCTCAAAGG + Intergenic
1194668289 X:96699600-96699622 CTAAATATACAAAATGTTATAGG - Intronic
1195449218 X:104991458-104991480 AAGAATGGACAGAATGTCAGAGG + Intronic
1195956678 X:110338639-110338661 CTGATTATAATGAATATCAGAGG - Intronic
1196345241 X:114648193-114648215 CTGAAAATACAGAGTCACAGAGG - Intronic
1196695276 X:118604859-118604881 CAGAACATACAGAATGCCTGGGG + Intronic
1198137271 X:133766167-133766189 CTGACTTTACCTAATGTCAGGGG - Intronic
1200360778 X:155604159-155604181 CTGAACATACCCATTGTCAGTGG + Intronic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1201237226 Y:11923094-11923116 CTCAATCTAGAGAATGTCAGGGG + Intergenic