ID: 1060962156

View in Genome Browser
Species Human (GRCh38)
Location 9:127688813-127688835
Sequence TCACCTACGTGGTTTCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060962156_1060962165 15 Left 1060962156 9:127688813-127688835 CCTTAAAGAAACCACGTAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1060962165 9:127688851-127688873 CCTGTTGCTGAGGGTCTTCGAGG No data
1060962156_1060962162 6 Left 1060962156 9:127688813-127688835 CCTTAAAGAAACCACGTAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1060962162 9:127688842-127688864 AGGCCACAGCCTGTTGCTGAGGG No data
1060962156_1060962161 5 Left 1060962156 9:127688813-127688835 CCTTAAAGAAACCACGTAGGTGA 0: 1
1: 0
2: 1
3: 6
4: 90
Right 1060962161 9:127688841-127688863 TAGGCCACAGCCTGTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060962156 Original CRISPR TCACCTACGTGGTTTCTTTA AGG (reversed) Intronic
902969012 1:20033250-20033272 ACACCTACGTGGTTCATTAACGG - Intronic
904023199 1:27484129-27484151 GCAGCTACTTGGTTTCTTAAAGG + Intronic
909359710 1:74746086-74746108 TCACTTAGGTGGTGTTTTTACGG - Intronic
912344152 1:108948631-108948653 TTTCCTAAGTTGTTTCTTTAAGG - Intronic
913311974 1:117508016-117508038 TCTCCCACGTGGATTCTCTATGG + Intronic
915700924 1:157795913-157795935 TCTCCTAGGTAGTTTCTTCAGGG + Exonic
915846282 1:159269026-159269048 TCACTTACGTGGTTGCTGTCAGG + Intergenic
919593383 1:199531814-199531836 TCACCCAAGAGTTTTCTTTATGG - Intergenic
919675696 1:200380538-200380560 CCACCTGGCTGGTTTCTTTAGGG - Intergenic
923610660 1:235489974-235489996 TTACCTTCCTGGTTTCTCTACGG + Intronic
1066091497 10:32025720-32025742 TCACCTATGTGGTTACTTTGAGG - Intronic
1078323254 11:10356062-10356084 TCACTTACGTGGTTTATTCGTGG + Intronic
1084928599 11:72535524-72535546 TCAACTTCTTAGTTTCTTTAAGG - Intergenic
1092125156 12:6070197-6070219 TCTCCTTCGTGCCTTCTTTAAGG + Intronic
1099398792 12:82176598-82176620 TGACCTACATGGTTTATTGATGG + Intergenic
1102038239 12:109784134-109784156 TCACCTACGTGGCTTCATCCTGG - Intronic
1104422064 12:128644460-128644482 TCATCCCAGTGGTTTCTTTATGG - Intronic
1105285113 13:18997012-18997034 TGACCTACTTGGTTCCTTTCTGG - Intergenic
1106501302 13:30331493-30331515 TCTCCTGCGTGGTTTCTGAAAGG + Intergenic
1112250752 13:97777140-97777162 TCAGCTATGTGGTGTCTTTTTGG + Intergenic
1114989555 14:28270798-28270820 TCACATACGTGGTGTCTTTAAGG - Intergenic
1122219591 14:100228098-100228120 TCCCCTAGGTGGTTTCTAGAAGG + Intergenic
1122258907 14:100500690-100500712 TGTCCTACGTGGCTTCTTTGGGG + Intronic
1132387769 15:101412473-101412495 TCACCTAGGTGTTTTTTTCATGG - Intronic
1134453069 16:14375155-14375177 CCAGCTACATGGTTTCTTTTTGG + Intergenic
1139049279 16:63103325-63103347 TCATATACGTGATTTATTTAAGG - Intergenic
1139282025 16:65779311-65779333 TGACTTACGAGGTTTATTTAGGG + Intergenic
1140676055 16:77331010-77331032 TCATCTACTTGTTTTATTTATGG + Intronic
1145953953 17:28841895-28841917 ACACATATGTGCTTTCTTTATGG - Intronic
1145963026 17:28898322-28898344 TGACCTCCGTGGTTACTTTCTGG - Exonic
1146601980 17:34225376-34225398 TCACCTTCCTGGTGCCTTTAAGG + Intergenic
1159439359 18:68457466-68457488 GCACCTGCCTGGTTTCTTTATGG - Intergenic
1159781320 18:72663964-72663986 TCACATTAGTGGTTTCTTTAAGG - Intergenic
1165181231 19:33972801-33972823 TAGCCTATGTGGTTTCTGTAGGG - Intergenic
926838972 2:17057524-17057546 ATACCTTCCTGGTTTCTTTAAGG - Intergenic
931450339 2:62362821-62362843 CCAACAACGTAGTTTCTTTAGGG + Intergenic
934927507 2:98391843-98391865 TCTCCCACATGGCTTCTTTAGGG + Exonic
935545227 2:104394252-104394274 TCACCTTCCTGCTTTCTTTAAGG + Intergenic
935870932 2:107449120-107449142 CCACCTATGTGTTTTCTTTTTGG - Intergenic
940861873 2:158779156-158779178 TAACCTATGTGGTTTCTGTCTGG - Intergenic
946717213 2:222565266-222565288 TCACCTACATGATTTGCTTAAGG + Intergenic
1173817661 20:46000194-46000216 TCACCTAGTTGGCCTCTTTATGG + Intergenic
1177726434 21:24974053-24974075 TCAAAAAAGTGGTTTCTTTAGGG - Intergenic
1183281637 22:36935608-36935630 TCACCTCCGTGGTGTCTTCCAGG + Exonic
953460415 3:43077494-43077516 TCACCTCTGTGCTTTCTGTATGG - Intergenic
956655953 3:71550653-71550675 TCACATAAGTGGTATCCTTATGG - Intronic
957207764 3:77219540-77219562 TCACCTGAGTGCTTTCTTTTGGG + Intronic
960393212 3:117104747-117104769 TCACTTACATGGTTTTTTTAAGG - Intronic
964904243 3:161698793-161698815 TCACGTAAGAAGTTTCTTTATGG + Intergenic
971645394 4:29193702-29193724 TCTCCTTCGTGTTTTCTCTAAGG + Intergenic
977329316 4:95617467-95617489 TCACCTACTTGTTCTCTTTTGGG + Intergenic
978961815 4:114688767-114688789 TCACTGACATGGTTTCTTCATGG - Intergenic
983781973 4:171680284-171680306 TTATCTACATTGTTTCTTTATGG + Intergenic
984780505 4:183521679-183521701 TCACTTTCGTGGTTTCGTCACGG + Intergenic
984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG + Intronic
986276921 5:6283868-6283890 TCAGCTACTTCTTTTCTTTAGGG + Intergenic
987628921 5:20442348-20442370 TCACATAAGTAGTTTATTTACGG - Intronic
990508625 5:56469976-56469998 GCACATAGGTGGTTTCTTTTGGG + Intronic
998264151 5:140654572-140654594 TTACTTACTTGGTTTCTTTCTGG - Exonic
998411756 5:141916419-141916441 TCAGGTACGGGGTTTCTTTGAGG + Intergenic
1007292019 6:40794856-40794878 TCACTTGGGTGGTTTCTTTCTGG + Intergenic
1013522742 6:110947750-110947772 TCAGATAGGTGGGTTCTTTAAGG - Intergenic
1017441277 6:154466525-154466547 TCCCCAACATGTTTTCTTTAAGG - Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1019141624 6:169950384-169950406 TCACCTGCCAGGTCTCTTTATGG - Intergenic
1020176882 7:5889080-5889102 TCATCCACGTTGTTTCTTTGAGG - Intergenic
1026332835 7:69367835-69367857 TCAGCTCTGTGGTTTCTTTTTGG - Intergenic
1029081956 7:97981920-97981942 TCATCCACGTTGTTTCTTTGAGG + Intergenic
1030436176 7:109523629-109523651 TCACCTACGTAATTTGTTTGGGG + Intergenic
1031527756 7:122842092-122842114 TCACACATGTGGTTGCTTTATGG + Intronic
1031959627 7:127976913-127976935 TCCCCTACATGGTGTCTTGAGGG + Intronic
1036093675 8:5698529-5698551 TCACATATGGGGATTCTTTAAGG - Intergenic
1037996506 8:23356435-23356457 CCACCTACGTGGGATATTTATGG - Intronic
1041314507 8:56547118-56547140 CCACCAACCTGGTTTGTTTAGGG + Intergenic
1042642815 8:70954369-70954391 GCACCTACGTGGTGACTTTGTGG - Intergenic
1057730187 9:97601858-97601880 TCACATACGTGGGTTCTGTAGGG + Exonic
1057832611 9:98418650-98418672 TCACTTCCGGGGTATCTTTAAGG - Intronic
1058177980 9:101760416-101760438 TCACCAACTTAGTTTTTTTATGG + Intergenic
1060634249 9:125187778-125187800 TCTGCTATGTGGTTTTTTTAAGG - Intronic
1060962156 9:127688813-127688835 TCACCTACGTGGTTTCTTTAAGG - Intronic
1189888534 X:45575592-45575614 TCAAATATGTGGTTGCTTTATGG + Intergenic
1189922290 X:45914421-45914443 TCATATACGTGGGTTCTGTAGGG + Intergenic
1191103955 X:56760773-56760795 TCACCTACATGGTCACTTTGGGG + Intergenic
1191107958 X:56783904-56783926 CCACCTACGTGGTCACTTTGGGG + Intergenic
1191108800 X:56789202-56789224 CCACCTACGTGGTCACTTTGGGG + Intergenic
1191110455 X:56799824-56799846 CCACCTATGTGGTTACTTTGGGG + Intergenic
1191111145 X:56803885-56803907 CCACCTACATGGTCTCTTTGGGG + Intergenic
1193640517 X:84005524-84005546 TCTCCCACTTGGTTTCTTTGCGG - Intergenic
1194420978 X:93672698-93672720 TCACCTCTGGGTTTTCTTTAGGG + Exonic
1198371436 X:135993235-135993257 TCATCTACTTTCTTTCTTTATGG - Intronic
1201791395 Y:17844835-17844857 TCACTCAAGTGATTTCTTTATGG + Intergenic
1201810159 Y:18061154-18061176 TCACTCAAGTGATTTCTTTATGG - Intergenic
1202353008 Y:24014480-24014502 TCACTCAAGTGATTTCTTTACGG + Intergenic
1202362246 Y:24123182-24123204 TCAATCACGTGATTTCTTTACGG - Intergenic
1202362827 Y:24129914-24129936 TCAATCACGTGATTTCTTTACGG + Intergenic
1202507951 Y:25540201-25540223 TCAATCACGTGATTTCTTTACGG - Intergenic
1202508533 Y:25546933-25546955 TCAATCACGTGATTTCTTTACGG + Intergenic
1202517771 Y:25655635-25655657 TCACTCAAGTGATTTCTTTACGG - Intergenic