ID: 1060962293

View in Genome Browser
Species Human (GRCh38)
Location 9:127689760-127689782
Sequence TGGGCATGACTCCAATACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060962293_1060962302 15 Left 1060962293 9:127689760-127689782 CCCTGGTATTGGAGTCATGCCCA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1060962302 9:127689798-127689820 CCTTCTTTTGCCTGCCCTTGGGG No data
1060962293_1060962300 14 Left 1060962293 9:127689760-127689782 CCCTGGTATTGGAGTCATGCCCA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1060962300 9:127689797-127689819 GCCTTCTTTTGCCTGCCCTTGGG No data
1060962293_1060962303 18 Left 1060962293 9:127689760-127689782 CCCTGGTATTGGAGTCATGCCCA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1060962303 9:127689801-127689823 TCTTTTGCCTGCCCTTGGGGTGG No data
1060962293_1060962299 13 Left 1060962293 9:127689760-127689782 CCCTGGTATTGGAGTCATGCCCA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1060962299 9:127689796-127689818 AGCCTTCTTTTGCCTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060962293 Original CRISPR TGGGCATGACTCCAATACCA GGG (reversed) Intronic
904973076 1:34434426-34434448 TGGGCAGGACTCCAAAACAGAGG - Intergenic
905539036 1:38745564-38745586 TGGACATGCCTTCAATTCCAGGG + Intergenic
906810592 1:48823381-48823403 TTGGCTAGACTCCAACACCAGGG + Intronic
911105299 1:94125902-94125924 TAGGAGTGACTCCAACACCAAGG + Intergenic
913419596 1:118650472-118650494 TGGGCTTGCTTCCAATAGCAAGG - Intergenic
913595089 1:120367712-120367734 TTCGCATGACTCAAATATCAAGG - Intergenic
914092182 1:144511273-144511295 TTCGCATGACTCAAATATCAAGG + Intergenic
914306350 1:146422592-146422614 TTCGCATGACTCAAATATCAAGG - Intergenic
914595698 1:149150211-149150233 TTCGCATGACTCAAATATCAAGG + Intergenic
918803403 1:189003354-189003376 TTGGCATGCTTTCAATACCAGGG - Intergenic
920182990 1:204143909-204143931 AGGGCATGGATCCAACACCAAGG + Intronic
921256769 1:213348510-213348532 TGAGGATGACACCAACACCAAGG + Intergenic
1069459544 10:68581629-68581651 TGGGCTGGTCTCCAATGCCAGGG - Intronic
1074103842 10:110374530-110374552 AGGGCATGACTTGAATCCCAGGG + Intergenic
1079362650 11:19782102-19782124 TGGACATGACTTCAGTACCTGGG - Intronic
1082277188 11:50234543-50234565 TGGGCTGGTCTCCAATGCCAGGG - Intergenic
1085773971 11:79349056-79349078 TGCCCAGGACTACAATACCAGGG + Intronic
1089693210 11:120199382-120199404 TGGGCATGAAGCCAAGACAAGGG + Intergenic
1090488178 11:127133600-127133622 TTGGCATGAATCCAGCACCACGG - Intergenic
1091798559 12:3310707-3310729 TGGGCCTGACTCCCAGCCCATGG - Intergenic
1095861011 12:46918031-46918053 TTGGCAAGAGTCCAATTCCAAGG - Intergenic
1096982088 12:55734027-55734049 TTGGCAAGACTACATTACCATGG + Intergenic
1100559451 12:95733625-95733647 TGTGTTTGGCTCCAATACCAGGG + Intronic
1102821495 12:115912848-115912870 TGGGCAGGACTCCCATACGTGGG - Intergenic
1103654250 12:122457645-122457667 TAGGCCTGACTCCAATATGATGG + Intergenic
1104090022 12:125508565-125508587 ATGGCATGACTCCAGGACCATGG + Intronic
1112046049 13:95599514-95599536 CAGGCATGACTAAAATACCATGG - Intronic
1113426488 13:110212687-110212709 AGGGCATGACTCCATTAACCGGG - Intronic
1116341983 14:43735416-43735438 TGAACATGAATCCAATGCCATGG - Intergenic
1118496978 14:66316555-66316577 TAGTAATGACTCCAATACCCAGG - Intergenic
1118960967 14:70532424-70532446 TGGGCATGACACCAAAAGCACGG + Intronic
1120599791 14:86488651-86488673 TGTGTATGACTCCAATTCCTTGG + Intergenic
1130955772 15:88626367-88626389 TGAGCATGCCTCCAGAACCAGGG + Exonic
1131577645 15:93607732-93607754 TGGGCATGACCCGGATGCCAGGG - Intergenic
1135069986 16:19343446-19343468 TGCTCATGAAGCCAATACCATGG - Intergenic
1136112133 16:28070331-28070353 TGGCCCTGACTCCAACACCCAGG + Intergenic
1139507387 16:67405978-67406000 TGGGCATGCCTAAAATACCTAGG - Intronic
1144688557 17:17243411-17243433 AGGGCATTACACAAATACCAAGG - Intergenic
1149058146 17:52389531-52389553 TGGTCATGACTCCTATCCCTAGG + Intergenic
1149998246 17:61416220-61416242 TGGGCTTGACCCCAAGAGCAAGG - Intergenic
1156574578 18:38299810-38299832 GGGGCATGACAGCTATACCACGG + Intergenic
1158004114 18:52652515-52652537 TGAGCATGACTCTAATAACATGG + Intronic
1158410977 18:57206006-57206028 TGGGAAGGAATCCATTACCAGGG - Intergenic
1161936589 19:7376100-7376122 TGGCCATGACTCCAACCCAAGGG + Intronic
1165077816 19:33290499-33290521 TGGGCAGGACACCAGTCCCAGGG + Intergenic
1165245094 19:34494071-34494093 TGCCCAGGACTCCAATCCCACGG - Intronic
1165449201 19:35872469-35872491 TGGGAGTGACTGCAAGACCAGGG - Exonic
1166331740 19:42081695-42081717 TGGGCATGGCTCTCATAGCAGGG + Intergenic
1167381564 19:49141245-49141267 TGGGGATGACTCCAATTCATGGG + Intronic
1168525650 19:57086986-57087008 AGGGTATCACTCCAATACCCAGG + Intergenic
925603775 2:5637055-5637077 TTCGCATGACTCAAATACCAAGG - Intergenic
926147464 2:10405374-10405396 AGGGCATGGCTCCAAGACCCTGG + Intronic
930446504 2:51480415-51480437 TGGATATGACTCCAAAAGCATGG + Intergenic
933004363 2:76971560-76971582 TGGGCACAGCTCCAATCCCAAGG + Intronic
934913537 2:98279737-98279759 TGGGCAGGACACCAATACCCCGG + Intronic
935110266 2:100086659-100086681 TGGGCTTGAATCTATTACCAAGG + Intronic
937017788 2:118621436-118621458 TGGACTTGCCTCCAATACCAAGG - Intergenic
939795615 2:146640990-146641012 GGGCCCTGACTCCAATACCAAGG + Intergenic
943181344 2:184546123-184546145 TGGGCCTGAATCCAATATGATGG - Intergenic
946814676 2:223564708-223564730 TGGCCATGACTGCAATGCTAAGG - Intergenic
947936682 2:234011011-234011033 TGGATATGACTCCAAAAGCAAGG - Intronic
1171460036 20:25292976-25292998 TGGGCAGGACCCCACTGCCAGGG + Intronic
949861154 3:8505958-8505980 TGGGCATGTCTCCAATGTCTTGG - Intronic
952298650 3:32084766-32084788 TGGGCATGACTGCTTTCCCACGG - Intergenic
955379138 3:58422659-58422681 TGGTAATGACGCCAAAACCAAGG + Intronic
956022090 3:64943898-64943920 TGAGCAAGAATCCAATATCATGG - Intergenic
957428207 3:80067762-80067784 TGGACATGACAACAACACCATGG + Intergenic
960163445 3:114375566-114375588 TGGGCATGCCTGCAATTCAAGGG + Intronic
960888440 3:122420071-122420093 TGGGAATCACTCCCATGCCACGG - Intergenic
962559563 3:136591415-136591437 TGGCCATGACGCCAAGCCCAGGG - Intronic
965284880 3:166805784-166805806 TGGGCCTGGCTCCACTGCCAGGG + Intergenic
969712579 4:8852483-8852505 TCGGCCTGACTCCAATGCCCGGG + Intronic
969980983 4:11154279-11154301 TGAGCATGTCTGAAATACCATGG - Intergenic
978393666 4:108254650-108254672 TGGGCATCACACCAAGATCAGGG + Intergenic
979120249 4:116890042-116890064 GGGCCATGACTACAATAACATGG + Intergenic
980558923 4:134445578-134445600 GGGGCATAAATCCAATAACAGGG + Intergenic
993669149 5:90739830-90739852 TGGGCTTGCCTCCCATACTAGGG + Intronic
996367129 5:122715057-122715079 TTGCAAGGACTCCAATACCATGG + Intergenic
996765067 5:127027935-127027957 TGGGCAGGACTTCAGTCCCAGGG - Intronic
997805151 5:136910175-136910197 TGGGCATGACTCAAATAAAAAGG + Intergenic
998509080 5:142696421-142696443 TGGGAATGACTCCATGCCCATGG + Intronic
999126505 5:149250113-149250135 TGAGCTTGACTTCAATTCCAGGG + Intronic
1006465278 6:34190175-34190197 GGGGCATTACTTCAAGACCATGG + Intergenic
1006535844 6:34697931-34697953 TGTGCATGACTCCAGAACCTAGG - Intergenic
1007930606 6:45687282-45687304 TGGAGATGACTCCCATGCCAGGG - Intergenic
1015028421 6:128565630-128565652 TTGAGATGACTCAAATACCAGGG - Intergenic
1016827241 6:148399828-148399850 TGGTCCTGACTCCAAAAACAGGG - Intronic
1017547820 6:155470344-155470366 AGGGCAGGACTCCAATATGATGG - Intergenic
1017576947 6:155815939-155815961 TGGGGATGGCTCCACTCCCATGG + Intergenic
1017715898 6:157212934-157212956 TGGGCATGACACCCATCTCAGGG + Intergenic
1018557647 6:165065273-165065295 TGGGAATAACTCCCAAACCAGGG - Intergenic
1019508982 7:1407795-1407817 TGGGCTTCTCTCCAATGCCAGGG + Intergenic
1019659440 7:2215805-2215827 TGGGCGTGACCACAATACCGAGG + Intronic
1022294357 7:29035925-29035947 TGCCCATGATTCCAATTCCAGGG - Intronic
1023250290 7:38252976-38252998 TGGACCTGACTCCAACACCCGGG + Intergenic
1023251601 7:38269087-38269109 TGGACCTGACTCCAACACCCGGG + Intergenic
1032066979 7:128779091-128779113 TGGGCAGGACTTCAGGACCAGGG + Intergenic
1038768072 8:30448977-30448999 TAGGCCTGACTTCAATCCCAGGG - Intronic
1045376329 8:101578154-101578176 TGGGCATGAATTCATTGCCAAGG + Intronic
1047436577 8:124839876-124839898 TGGGCCTGAGCCCAATACCCAGG - Intergenic
1049244494 8:141554768-141554790 CGGACATGCCTCCAACACCATGG - Intergenic
1049244505 8:141554828-141554850 TGGGCATGCCTGCAGTGCCATGG - Intergenic
1049244525 8:141554985-141555007 TGGACACGCCTCCAACACCATGG - Intergenic
1049244529 8:141555005-141555027 TGAGAATGCCTCCAACACCATGG - Intergenic
1052247522 9:26354410-26354432 TGGGTATGACACCAAAAGCATGG + Intergenic
1053609486 9:39697609-39697631 TGGGGATGGCTCAAAGACCAGGG - Intergenic
1053867383 9:42454194-42454216 TGGGGATGGCTCAAAGACCAGGG - Intergenic
1054088829 9:60773883-60773905 TGGGGATGGCTCAAAGACCAGGG + Intergenic
1054244038 9:62644788-62644810 TGGGGATGGCTCAAAGACCAGGG + Intergenic
1054558163 9:66679336-66679358 TGGGGATGGCTCAAAGACCAGGG + Intergenic
1056205225 9:84313321-84313343 GGTGCATGACTCTAGTACCATGG - Intronic
1057950483 9:99365730-99365752 TAGGCCTGACTCAAATTCCATGG + Intergenic
1060962293 9:127689760-127689782 TGGGCATGACTCCAATACCAGGG - Intronic
1186001187 X:5012794-5012816 TGGGTATGACTTCAAAAACAAGG + Intergenic
1190161350 X:48033682-48033704 AAGGCATGTCTACAATACCAGGG + Intronic
1197843045 X:130770769-130770791 AGGAAATGACTCAAATACCAGGG + Intronic
1200024407 X:153244321-153244343 TGGGCATGCCTCGAATTCAAGGG + Intergenic
1200406504 Y:2817428-2817450 TCAGCATCACTCTAATACCAAGG - Intergenic