ID: 1060962879

View in Genome Browser
Species Human (GRCh38)
Location 9:127693559-127693581
Sequence CGGGGAGTGAGACCCTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060962866_1060962879 29 Left 1060962866 9:127693507-127693529 CCCGTAAGTGAGGGTCGAGGCCA 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1060962879 9:127693559-127693581 CGGGGAGTGAGACCCTTTGTAGG No data
1060962867_1060962879 28 Left 1060962867 9:127693508-127693530 CCGTAAGTGAGGGTCGAGGCCAC 0: 1
1: 0
2: 0
3: 8
4: 55
Right 1060962879 9:127693559-127693581 CGGGGAGTGAGACCCTTTGTAGG No data
1060962870_1060962879 9 Left 1060962870 9:127693527-127693549 CCACACGGGAAACTTGCTAGAAT 0: 1
1: 0
2: 2
3: 6
4: 70
Right 1060962879 9:127693559-127693581 CGGGGAGTGAGACCCTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060962879 Original CRISPR CGGGGAGTGAGACCCTTTGT AGG Intronic
No off target data available for this crispr