ID: 1060963783

View in Genome Browser
Species Human (GRCh38)
Location 9:127700300-127700322
Sequence CCTCCCACCCACACCCCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060963780_1060963783 -6 Left 1060963780 9:127700283-127700305 CCTGTGCTGTCTTTCCACCTCCC 0: 1
1: 0
2: 5
3: 38
4: 409
Right 1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG No data
1060963779_1060963783 -5 Left 1060963779 9:127700282-127700304 CCCTGTGCTGTCTTTCCACCTCC 0: 1
1: 0
2: 2
3: 41
4: 437
Right 1060963783 9:127700300-127700322 CCTCCCACCCACACCCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060963783 Original CRISPR CCTCCCACCCACACCCCTTA TGG Intronic
No off target data available for this crispr