ID: 1060964506

View in Genome Browser
Species Human (GRCh38)
Location 9:127705243-127705265
Sequence GCTGATGGGCCCAGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060964506_1060964511 1 Left 1060964506 9:127705243-127705265 CCAGCAGCTCTGGGCCCATCAGC No data
Right 1060964511 9:127705267-127705289 TCAGTCTCCAAGACTACGGAAGG No data
1060964506_1060964509 -3 Left 1060964506 9:127705243-127705265 CCAGCAGCTCTGGGCCCATCAGC No data
Right 1060964509 9:127705263-127705285 AGCCTCAGTCTCCAAGACTACGG No data
1060964506_1060964513 8 Left 1060964506 9:127705243-127705265 CCAGCAGCTCTGGGCCCATCAGC No data
Right 1060964513 9:127705274-127705296 CCAAGACTACGGAAGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060964506 Original CRISPR GCTGATGGGCCCAGAGCTGC TGG (reversed) Intronic