ID: 1060965074

View in Genome Browser
Species Human (GRCh38)
Location 9:127707635-127707657
Sequence CAGTTTCCCCAAATATAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060965068_1060965074 3 Left 1060965068 9:127707609-127707631 CCCAGTTGTTTCTCCATGCTGGG 0: 1
1: 0
2: 0
3: 17
4: 178
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965066_1060965074 15 Left 1060965066 9:127707597-127707619 CCAGCACATGAGCCCAGTTGTTT 0: 1
1: 0
2: 2
3: 7
4: 145
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965071_1060965074 -10 Left 1060965071 9:127707622-127707644 CCATGCTGGGCCTCAGTTTCCCC 0: 2
1: 60
2: 433
3: 1672
4: 4633
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965065_1060965074 16 Left 1060965065 9:127707596-127707618 CCCAGCACATGAGCCCAGTTGTT 0: 1
1: 0
2: 0
3: 28
4: 213
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965063_1060965074 28 Left 1060965063 9:127707584-127707606 CCCACTGACTCACCCAGCACATG 0: 1
1: 0
2: 4
3: 21
4: 237
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965062_1060965074 29 Left 1060965062 9:127707583-127707605 CCCCACTGACTCACCCAGCACAT 0: 1
1: 0
2: 3
3: 37
4: 283
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965070_1060965074 2 Left 1060965070 9:127707610-127707632 CCAGTTGTTTCTCCATGCTGGGC 0: 1
1: 0
2: 1
3: 16
4: 158
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data
1060965064_1060965074 27 Left 1060965064 9:127707585-127707607 CCACTGACTCACCCAGCACATGA 0: 1
1: 0
2: 3
3: 31
4: 206
Right 1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060965074 Original CRISPR CAGTTTCCCCAAATATAAGT GGG Intronic
No off target data available for this crispr