ID: 1060969576

View in Genome Browser
Species Human (GRCh38)
Location 9:127730472-127730494
Sequence CTGGGTCGCTGGGGGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 846
Summary {0: 1, 1: 0, 2: 1, 3: 98, 4: 746}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060969559_1060969576 4 Left 1060969559 9:127730445-127730467 CCATCTCACAGCCCCACCCCTCA 0: 1
1: 0
2: 8
3: 107
4: 870
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969564_1060969576 -7 Left 1060969564 9:127730456-127730478 CCCCACCCCTCAGGGTCTGGGTC 0: 1
1: 0
2: 1
3: 35
4: 319
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969566_1060969576 -9 Left 1060969566 9:127730458-127730480 CCACCCCTCAGGGTCTGGGTCGC 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969558_1060969576 5 Left 1060969558 9:127730444-127730466 CCCATCTCACAGCCCCACCCCTC 0: 1
1: 0
2: 4
3: 91
4: 716
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969565_1060969576 -8 Left 1060969565 9:127730457-127730479 CCCACCCCTCAGGGTCTGGGTCG 0: 1
1: 0
2: 0
3: 18
4: 120
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969556_1060969576 7 Left 1060969556 9:127730442-127730464 CCCCCATCTCACAGCCCCACCCC 0: 1
1: 0
2: 9
3: 126
4: 973
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969555_1060969576 18 Left 1060969555 9:127730431-127730453 CCTAGGCATCTCCCCCATCTCAC 0: 1
1: 0
2: 0
3: 33
4: 348
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746
1060969557_1060969576 6 Left 1060969557 9:127730443-127730465 CCCCATCTCACAGCCCCACCCCT 0: 1
1: 0
2: 12
3: 102
4: 823
Right 1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG 0: 1
1: 0
2: 1
3: 98
4: 746

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060969576 Original CRISPR CTGGGTCGCTGGGGGCTGGG CGG Intronic
900091899 1:924341-924363 TTGGGTCGCGGGGGCCGGGGAGG - Intergenic
900104164 1:975283-975305 CTGCCTGGCTGGGTGCTGGGTGG - Exonic
900110108 1:1001717-1001739 CAGGGGCGCGGGGGGCTGCGAGG + Intergenic
900158253 1:1212036-1212058 CTGGGTCTCCTGGGGCTGCGTGG + Exonic
900406418 1:2495044-2495066 CTGGGGCACTGGGAGCAGGGAGG - Intronic
900593143 1:3468643-3468665 TTGGGGCTCTGGCGGCTGGGGGG + Intronic
900594366 1:3473833-3473855 CTGGTGGGGTGGGGGCTGGGAGG - Intronic
900731820 1:4267126-4267148 CTGGGCTGCTGGGGGCAGAGTGG + Intergenic
900830244 1:4960410-4960432 GTGGCTCGCAGGGGGCTGTGTGG - Intergenic
900936162 1:5767487-5767509 CTGGCTGCCTGTGGGCTGGGTGG - Intergenic
901048659 1:6414787-6414809 ATGGATCTCTGGGGGCTGAGTGG - Intronic
901066611 1:6497371-6497393 CGGGGACGCCGGGGACTGGGAGG + Intronic
901644385 1:10708873-10708895 CTGGTGGGCTGGGCGCTGGGAGG + Intronic
901671028 1:10856552-10856574 CAGGGTGGCTGGGGCCTGGGAGG - Intergenic
901672189 1:10862458-10862480 TTGGGGGGCTGGGGGCTGTGGGG - Intergenic
901813269 1:11779643-11779665 GTGGGTTGCTGGGGACTGGAGGG - Intronic
903211159 1:21819613-21819635 CATGGTCACTAGGGGCTGGGGGG + Intronic
903360155 1:22772063-22772085 CGGGGTTGCTGGGGGTGGGGTGG - Intronic
903394581 1:22990021-22990043 CTGGGTCACTGGTGGCTGAGTGG + Intergenic
903785601 1:25859257-25859279 GTGGGACGCTGGGGGATGAGAGG - Intronic
903938816 1:26914494-26914516 CCAGGACCCTGGGGGCTGGGAGG + Intronic
904011605 1:27393217-27393239 CTGGGAGGGTGGGGGGTGGGGGG + Intronic
904035586 1:27557023-27557045 CTGTGTGGCTGGGGGTAGGGTGG - Intronic
904128819 1:28260508-28260530 CAGGGGCTCTGGGGGCTTGGCGG + Intronic
904190058 1:28736691-28736713 CTGGGGCGGTGGGGGCGGGGAGG + Intronic
904251010 1:29224288-29224310 CTGTCTGGCTGGAGGCTGGGAGG + Intronic
904311600 1:29632820-29632842 CTGAGGGGCTGGGGGCTGGGAGG - Intergenic
904466443 1:30710895-30710917 CTGTGAGGCTGGGGGTTGGGGGG - Intergenic
904575244 1:31501299-31501321 GTGGGGAGCTGGGGGCTGGGAGG + Intergenic
904622724 1:31784965-31784987 CTGGGGCAGTGGGGGCTGAGGGG + Intergenic
905046545 1:35007809-35007831 CTGTCTGGCTGGGGGATGGGGGG + Intronic
905328302 1:37174128-37174150 CTGGGAGGCTGGGGACTGGCAGG + Intergenic
905335246 1:37240490-37240512 CTGCTTGGGTGGGGGCTGGGAGG - Intergenic
905402976 1:37716545-37716567 CAGGGAGGCAGGGGGCTGGGGGG + Exonic
906545923 1:46619421-46619443 CTGGGTGTCTGTGGGATGGGAGG + Intergenic
906563439 1:46778464-46778486 CGGGGTTGCAGGGGGCTGGTGGG + Intronic
906645861 1:47474444-47474466 GTGGCTCGCTTGGGTCTGGGGGG + Intergenic
907080434 1:51617019-51617041 CGGGGCCGCAGGGGGCGGGGCGG - Intronic
907449306 1:54532953-54532975 CAGGGTCTCTGGGGGGAGGGGGG + Intergenic
907512957 1:54975911-54975933 CTGGGTTGGAGGGGGCTAGGGGG + Intergenic
907689087 1:56645079-56645101 CGGGGACGCGGGGCGCTGGGCGG - Intronic
910605571 1:89080081-89080103 CTGGCTGCCTGTGGGCTGGGTGG + Intergenic
914000666 1:143691848-143691870 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914197985 1:145460043-145460065 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914477087 1:148033175-148033197 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914503094 1:148264786-148264808 CTGGGTCGCTGGGTCCCTGGCGG + Intergenic
914510632 1:148329200-148329222 CTGGGTCGCTGGGTCCCTGGCGG - Intergenic
914673449 1:149889447-149889469 CCGGGTGGGTGGGGGCGGGGTGG - Intronic
914863775 1:151408365-151408387 CTGGGCGGGTGGGGACTGGGTGG - Intronic
914903894 1:151728472-151728494 CGGGGTAGGTGGGGGGTGGGGGG + Intronic
915079313 1:153340697-153340719 CAGGGTGGTTGGGGGCAGGGTGG - Intronic
915111204 1:153565675-153565697 CTGGGAGGGAGGGGGCTGGGAGG - Exonic
915311457 1:155007715-155007737 ATGGGGCGCTGGGAGCAGGGGGG + Intronic
915491243 1:156251075-156251097 AGGGGCAGCTGGGGGCTGGGAGG + Intronic
915587794 1:156853687-156853709 CAGGGTCACATGGGGCTGGGTGG - Intronic
915903048 1:159860017-159860039 CAGGGTTGCTGGAGACTGGGAGG - Intronic
916713451 1:167431853-167431875 CTGGGCCTCTGGAGGCTGGGTGG - Intronic
917963819 1:180166141-180166163 CTGGGGGGTGGGGGGCTGGGGGG + Intronic
918205885 1:182308907-182308929 CTAGGTGCCTGGAGGCTGGGAGG - Intergenic
919810375 1:201405519-201405541 CTGGGCAGCCGGGGGCGGGGGGG - Exonic
920002384 1:202808522-202808544 GTGGGTCGATGGGGGTGGGGTGG - Exonic
920074619 1:203327300-203327322 GTGGGTGGCTGGGGGGTGAGCGG - Intergenic
920111883 1:203592616-203592638 CAGGGAAGTTGGGGGCTGGGAGG + Intergenic
920255479 1:204651610-204651632 CTGGTTTGCCTGGGGCTGGGGGG - Intronic
921152711 1:212414655-212414677 CAGGGTCCCGGGGGCCTGGGCGG - Intronic
921897074 1:220412488-220412510 CTGGGTGGGTGTGGGCTTGGCGG + Intergenic
922218480 1:223539821-223539843 CTGGGTCTCTGTTGGCAGGGAGG - Intronic
922899322 1:229123888-229123910 CTGAGGGGCTGGAGGCTGGGTGG - Intergenic
923154830 1:231269089-231269111 CTGGGTTGCAGAGGGCAGGGTGG + Intronic
923910749 1:238440508-238440530 GTGTGGCGTTGGGGGCTGGGGGG + Intergenic
924439469 1:244074267-244074289 CTGGGTGGCTGGCGGCAGGGTGG + Intergenic
924649962 1:245917136-245917158 CTGGGAAGCTGAGGGGTGGGAGG - Intronic
1063153265 10:3355694-3355716 CGGGGTCGGGGGGAGCTGGGAGG + Intergenic
1063158697 10:3403388-3403410 CTGGGCCTCTGGGGACTGGGGGG + Intergenic
1063352279 10:5366621-5366643 GTGAGTGGCTGGGGGCTGGAAGG - Intronic
1063382012 10:5591518-5591540 CTGGGGCCCTGCGGGCTGTGGGG - Intergenic
1064334521 10:14426554-14426576 ATGGGTGGATGGGGGCTGTGGGG + Intronic
1064457013 10:15497146-15497168 CTTGGTCTCTGTTGGCTGGGTGG + Intergenic
1066296087 10:34055611-34055633 CCGGGTGGGTGGGGGATGGGCGG + Intergenic
1067080507 10:43209801-43209823 CTGGCTCTCTGGGGTCAGGGTGG - Intronic
1067342723 10:45418280-45418302 CTGGGCCGGTGGGGGTTGGGGGG + Intronic
1067561923 10:47310304-47310326 CTGAGTTGTTGGGGGCTGCGCGG - Exonic
1067920034 10:50445801-50445823 CTGGCTGCCTGTGGGCTGGGTGG + Intronic
1068344402 10:55754716-55754738 CTGGGAAGCTGGAGGGTGGGAGG + Intergenic
1068711666 10:60141591-60141613 CGGGGGCGGTGGGGGCTGGAGGG - Intronic
1069760720 10:70809321-70809343 CAGGGTAGCCGGGGGCGGGGGGG - Intergenic
1069769485 10:70888364-70888386 CTCTGTCGCTGGCGGCGGGGAGG - Intronic
1069925937 10:71850999-71851021 CTGGGCGGCTGGGGGCTGCGGGG - Intronic
1070482483 10:76896324-76896346 CTGGCTGCCTGTGGGCTGGGTGG - Intronic
1070499969 10:77063352-77063374 CTGGGTTGCTGGGGGAGAGGTGG + Intronic
1070558055 10:77545453-77545475 CTGGCACTCTGTGGGCTGGGTGG + Intronic
1070558150 10:77545949-77545971 CTGTGCCCCAGGGGGCTGGGGGG - Intronic
1070811168 10:79298770-79298792 CTGGGCGCCTGGAGGCTGGGAGG + Intronic
1070984543 10:80677499-80677521 CTGGTGCGCGGGGGGGTGGGGGG - Intergenic
1071611028 10:87031275-87031297 CTGGGTGGGTGTGGGCTTGGTGG - Intergenic
1071798355 10:89029949-89029971 CGAGGTTGGTGGGGGCTGGGAGG + Intergenic
1072102282 10:92240146-92240168 CCGGGCCGTTGGGGGCCGGGGGG + Exonic
1072189080 10:93066111-93066133 CGGGGCCGCTGGGGGCAGCGAGG + Exonic
1072359752 10:94647867-94647889 CAGTGCCACTGGGGGCTGGGGGG + Intergenic
1072508106 10:96090317-96090339 CTGGGCTGCTGGTGGCGGGGCGG + Intergenic
1072565080 10:96610539-96610561 GTGGGTGGGTGTGGGCTGGGTGG + Intronic
1072597220 10:96885469-96885491 GAGGGTCGCTAGGGCCTGGGAGG - Intronic
1072797267 10:98365612-98365634 CTGGGTTGTTGGTGGCTGTGTGG + Intergenic
1073135543 10:101218138-101218160 CAGGGTCGCTGGGGGGCGGCTGG + Intergenic
1073185413 10:101612678-101612700 CTGGGATGCTGGGGGAGGGGTGG - Intronic
1073500405 10:103931917-103931939 CTGGGTCGCTGCTGACTGGCTGG + Intergenic
1073510446 10:104039456-104039478 TTGGGTCCCTGGGGGCCAGGTGG + Exonic
1074509468 10:114099536-114099558 CTGGATGGCTGGGGAATGGGTGG + Intergenic
1074856972 10:117480805-117480827 CTGTGGTGCTGGTGGCTGGGAGG + Intergenic
1075275125 10:121086304-121086326 CTGGGAGGCTGGGGGCAGAGAGG - Intergenic
1075576972 10:123584612-123584634 CTGAGTCGCTGGTGACTGGGAGG - Intergenic
1075682279 10:124341515-124341537 CTGGGGTGATTGGGGCTGGGTGG - Intergenic
1076415697 10:130286719-130286741 GTGGGTGGCTGGAGGCTTGGTGG - Intergenic
1076666861 10:132098123-132098145 GAGGATCGCTTGGGGCTGGGAGG - Intergenic
1076833246 10:133007413-133007435 GTGCCTGGCTGGGGGCTGGGAGG - Intergenic
1076904412 10:133355026-133355048 CTGGGGCCCTGGGGACTGGGCGG - Intergenic
1077021964 11:420908-420930 CTGGGGCTCCCGGGGCTGGGCGG + Intronic
1077076823 11:705925-705947 CTGGGGCGCTGGGGACAGGCGGG - Intronic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077143519 11:1035104-1035126 CTGGGCCGCGGTGGGCCGGGAGG - Intronic
1077152200 11:1077396-1077418 CTGGGGCGGGGGGGCCTGGGTGG + Intergenic
1077181283 11:1218350-1218372 CTGGGGCACAGGGGGCTGAGGGG - Intergenic
1077254240 11:1573314-1573336 CAGGCTGGCTGGGGGCTCGGGGG - Intergenic
1077296082 11:1826888-1826910 CTGGGACGCTGGGTGCTGTGAGG - Intergenic
1077373688 11:2195370-2195392 CTGGGTGTCTGGGAGCTGTGTGG - Intergenic
1077414784 11:2420039-2420061 CTGGGCCGTGGGGGCCTGGGAGG - Intronic
1077423117 11:2462192-2462214 CTGGATTGGTGGGTGCTGGGTGG + Intronic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077500959 11:2909563-2909585 CTGGGCGGCTGGGGACGGGGCGG - Exonic
1078096551 11:8300829-8300851 CTGGGGCACTGGGGGCAGAGGGG - Intergenic
1079098908 11:17528614-17528636 CTAGGTAGGTAGGGGCTGGGTGG + Intronic
1079338301 11:19590428-19590450 CTGGGGTGCGGGGAGCTGGGAGG - Intronic
1080204399 11:29712703-29712725 CTGGGTGGGTGTGGGCTTGGCGG + Intergenic
1080700847 11:34642877-34642899 CTGGAACGCTGGGGGCTGGTAGG - Intronic
1080885347 11:36362848-36362870 CTGCATGGGTGGGGGCTGGGGGG + Intronic
1081625587 11:44653392-44653414 CTGGGGCGCCAGGGGGTGGGAGG + Intergenic
1081773709 11:45664557-45664579 CTGGGTCCCTGGAGCCTGGGAGG + Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1082846348 11:57728799-57728821 CTGGGTGACTGGGGGCTTTGTGG + Intronic
1083262167 11:61529080-61529102 CTGGGGCTCAGGCGGCTGGGGGG - Intronic
1083290221 11:61685823-61685845 CGGGGTGACTGGTGGCTGGGAGG + Intronic
1083572740 11:63768877-63768899 CCAGCTCGCGGGGGGCTGGGGGG + Intergenic
1083631107 11:64095972-64095994 ATGGGCCCCTGGGGGGTGGGGGG - Intronic
1083648267 11:64185651-64185673 CTGTGTCGCCGGCGGCTGCGGGG - Exonic
1083755146 11:64788292-64788314 CTGGGAAGGTGGGGGCAGGGTGG - Intergenic
1083756907 11:64796790-64796812 CGGGGTAGGTGGGGGCAGGGAGG - Exonic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084061338 11:66677537-66677559 GTGGGCCGCTGGGGGCGAGGTGG - Exonic
1084149816 11:67282838-67282860 CAGGGCCGCAGGGGGCTGGGGGG + Intronic
1084167465 11:67382549-67382571 CTGGGGAGATGGGGGCAGGGAGG - Intronic
1084214482 11:67639990-67640012 CTGGGGCCCCGGGGGTTGGGAGG + Intergenic
1084387853 11:68855321-68855343 CTGGGTCGGCGGCGGCTGGCAGG + Intergenic
1084403066 11:68956103-68956125 GTGGGGGGCTGGGGGTTGGGGGG + Intergenic
1084426433 11:69086814-69086836 CTGGGCTGCTGGGGCCTTGGGGG + Intronic
1084426445 11:69086850-69086872 CTGGGCTGCTGGGGCCTTGGGGG + Intronic
1084674183 11:70624607-70624629 CTGGTTCCCTGGGGTTTGGGGGG - Intronic
1084721449 11:70908346-70908368 CTGGTCTGCTGGGGGATGGGAGG - Intronic
1085031343 11:73272676-73272698 CGGGGTCAGTGGGGGCGGGGAGG + Intronic
1085446161 11:76602587-76602609 CTGGGCCTCCTGGGGCTGGGTGG + Intergenic
1085472718 11:76768482-76768504 CGGGCTGGCTGGGGGCAGGGGGG - Intergenic
1086735083 11:90296461-90296483 CTGGGTGGCAGGGGGGTGGGTGG + Intergenic
1086974272 11:93114689-93114711 ATGGGTGGCTGGTGGGTGGGGGG - Intergenic
1087279772 11:96197413-96197435 CTGACTCTTTGGGGGCTGGGAGG + Intronic
1087441203 11:98185522-98185544 CTGGGTGGGTGTGGGCTCGGTGG - Intergenic
1088893436 11:114061132-114061154 GGGGGTCGCTGGGAACTGGGGGG + Intronic
1089356200 11:117855577-117855599 CTGGGCTGCTGGAGGCTGGCTGG + Intronic
1089394857 11:118129989-118130011 CTGAGTGGGTGAGGGCTGGGAGG - Intergenic
1089402643 11:118173209-118173231 CTGGGGGGATGGGGGCTGGCAGG - Intronic
1089416720 11:118298223-118298245 CTGGGTAGATGGTGACTGGGTGG - Intergenic
1089496612 11:118911317-118911339 CGGGGCTGCTGGAGGCTGGGCGG + Intronic
1090375167 11:126283166-126283188 CGGGGTCGCGGGGGACCGGGAGG + Intronic
1090450930 11:126805837-126805859 CTGGTCTGCTGGGGGCTGAGTGG - Intronic
1090486460 11:127116764-127116786 CTGCCTCACTGGGGACTGGGAGG + Intergenic
1090599852 11:128358802-128358824 ATGGGTGGCTGAGGGCTGGGAGG - Intergenic
1091094629 11:132808974-132808996 TTTGGTCGGTGGGGGCGGGGGGG + Intronic
1091877439 12:3947565-3947587 CTTGATTGCTGGTGGCTGGGAGG + Intergenic
1091924694 12:4335882-4335904 CAGGATTGCTGGGGGCTGGAGGG - Intronic
1094564799 12:31590319-31590341 CCGGGTGGCTGGCGGGTGGGAGG + Intronic
1096797360 12:54086212-54086234 CTGGGTGGTTGGGGAGTGGGAGG - Intergenic
1097178330 12:57156456-57156478 GTGGGTGGATGGGGGCTGGCAGG - Intronic
1097676087 12:62603523-62603545 CCGAGCCGCTGGGTGCTGGGCGG + Exonic
1098597959 12:72295126-72295148 GGGGGTGGCTGGGGGATGGGGGG + Intronic
1099172889 12:79386503-79386525 CAGGGTCTGTGGGGGTTGGGGGG - Intronic
1099217183 12:79867307-79867329 CAGGGTCTGTGGGGGGTGGGGGG + Intronic
1101148262 12:101862214-101862236 CTACTTGGCTGGGGGCTGGGGGG - Intergenic
1101340946 12:103841344-103841366 CGGGGTCGATGGGGAGTGGGCGG + Intergenic
1101917884 12:108910363-108910385 CAGTGGAGCTGGGGGCTGGGGGG - Intergenic
1102025770 12:109713762-109713784 CTGGGCCGCGGGGGGCGGGCGGG + Intergenic
1102538150 12:113597357-113597379 CTTGGTTGCCGGGGGCTGGAAGG + Intergenic
1102680224 12:114685931-114685953 CGGGGTTGCTGGGGGTTGCGCGG - Intergenic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1103014002 12:117480164-117480186 CTGGGCCACTGGGGGTGGGGTGG + Intronic
1103080125 12:118017043-118017065 CTGGGTAGCTGGGGGGTGTCGGG - Intronic
1103092064 12:118104290-118104312 CTGTGTCCCTGGGCGCAGGGCGG + Intronic
1103562510 12:121800065-121800087 CCGGGCCGCTGGGGGAGGGGCGG - Intronic
1103564216 12:121807294-121807316 CTCAGTCTCTGGGGGTTGGGGGG + Intronic
1103698414 12:122835223-122835245 CGGGGTCGCCGCGGGATGGGGGG + Intronic
1103701408 12:122850424-122850446 CTGGTTCGGTGGCTGCTGGGTGG + Intronic
1103701421 12:122850454-122850476 CTGGTTCGGTGGCCGCTGGGTGG + Intronic
1103701436 12:122850485-122850507 CTGGTTCGGTGGCCGCTGGGTGG + Intronic
1103701451 12:122850516-122850538 CTGGTTCGGTGGCCGCTGGGTGG + Intronic
1103701467 12:122850548-122850570 CTGGTTCGGTGGCTGCTGGGTGG + Intronic
1103701480 12:122850578-122850600 CTGGTTCGGTGGCCGCTGGGTGG + Intronic
1103701510 12:122850640-122850662 CTGGTTCGGTGGCCGCTGGGTGG + Intronic
1103725547 12:122995820-122995842 CAGGGTGGCTGGTGGGTGGGAGG - Intronic
1104423106 12:128653246-128653268 AGTGGTTGCTGGGGGCTGGGAGG + Intronic
1104468626 12:129010163-129010185 CTGGTCGGCTGGGGGCTGGCTGG - Intergenic
1104879968 12:132063966-132063988 CTGTGTGGCTGTGGGCCGGGGGG - Intronic
1104879988 12:132064028-132064050 CTGTGTGGCTGTGGGCCGGGGGG - Intronic
1104880071 12:132064708-132064730 CTGTGGCGGTGGGGGCTGCGGGG - Exonic
1104896280 12:132166554-132166576 CTGGGTGGATGAGGGATGGGTGG - Intergenic
1104903709 12:132202694-132202716 CTGGGTCCCTGAGTTCTGGGAGG - Intronic
1104926386 12:132316159-132316181 CTGGGACGCTGGGGTCTGTGGGG - Intronic
1104972891 12:132539788-132539810 CTAGGTGGATGGGGGCTGGAGGG - Intronic
1104973053 12:132540238-132540260 CTAGGTGGATGGGGGCTGGAGGG - Intronic
1105061921 12:133160548-133160570 CTGGGTGGAAGGGGTCTGGGTGG + Intronic
1106242812 13:27924194-27924216 CTGCGTGGGTGGGGGCTGTGCGG + Intronic
1106250626 13:27979190-27979212 CCGGGCCGGTGGGGGATGGGTGG - Intronic
1106308268 13:28532413-28532435 CGCGGGCGCTCGGGGCTGGGCGG - Intergenic
1110368842 13:74718448-74718470 CTGGGTGGCCGTGGGCTTGGCGG + Intergenic
1113520588 13:110937822-110937844 CTGGGTCACTGGTTTCTGGGGGG - Intergenic
1113575308 13:111391007-111391029 CTGGGGCACTGGTGCCTGGGAGG + Intergenic
1113587565 13:111475723-111475745 CTGTCCTGCTGGGGGCTGGGAGG + Intergenic
1113778838 13:112964093-112964115 CAGGGTTGCAGGGGGCGGGGGGG + Intronic
1113904110 13:113811408-113811430 CTGGGTCTCCGGGGGAGGGGAGG + Intronic
1114334104 14:21670125-21670147 CTGGGAGGCTGGTGGATGGGCGG + Intergenic
1115528134 14:34301843-34301865 CAGGGTGGCTGGTGGCTGTGTGG - Intronic
1115958814 14:38811357-38811379 CTGGCTGCCTGCGGGCTGGGTGG - Intergenic
1116434799 14:44885006-44885028 TTGGGTGGGTGGGGGCGGGGGGG + Intergenic
1117803980 14:59470940-59470962 GGGGGTGGCTGGGGGCGGGGGGG + Intronic
1117942273 14:60981048-60981070 GTGGGTCGCGGGTGGATGGGCGG + Exonic
1117963911 14:61188311-61188333 TTGGGTAGCTGCGGGCTAGGAGG + Intronic
1118761994 14:68885635-68885657 CTGGGGCCCTGAGGGGTGGGCGG - Intronic
1119520368 14:75280153-75280175 CTGGGAATGTGGGGGCTGGGTGG + Intronic
1119602019 14:75982664-75982686 CTCGGGGGCTGGGGGCTGCGGGG + Intronic
1120439134 14:84513212-84513234 CTGGGTGGGTGTGGGCTTGGCGG - Intergenic
1120523318 14:85549292-85549314 CTGGGACTCTGGGGGCTTGTGGG + Intronic
1121622517 14:95360434-95360456 CTGGGAGGACGGGGGCTGGGGGG - Intergenic
1122288836 14:100668654-100668676 CTGGGTGCCTGGGTGCGGGGCGG - Intergenic
1122320580 14:100852886-100852908 CTGGTGCCCTGGAGGCTGGGTGG + Intergenic
1122324377 14:100873992-100874014 TTTGGTTGCTGAGGGCTGGGGGG - Intergenic
1122358092 14:101136340-101136362 CTGTGCAGGTGGGGGCTGGGAGG - Intergenic
1122542432 14:102505781-102505803 CAGGCACGCTGGGGGCAGGGTGG + Exonic
1122552270 14:102556467-102556489 CTGGGTCCATGGGCTCTGGGGGG - Intergenic
1122870569 14:104636309-104636331 TGGGGTGGCTGGAGGCTGGGTGG - Intergenic
1122945243 14:105005690-105005712 GAGGGTCACTGGGGACTGGGAGG - Intronic
1122981940 14:105196018-105196040 CTGGGTCTCTGGGAGCTGGTGGG - Intergenic
1123038823 14:105482188-105482210 CTGGCTGGCAGGCGGCTGGGAGG - Intergenic
1123066363 14:105621401-105621423 CTGGCTGGCTGCGGGCTGGGAGG + Intergenic
1123070504 14:105640453-105640475 CTGGCTGGCTGCGGGCTGGGAGG + Intergenic
1123075094 14:105664113-105664135 CTGGCTGGCTGCGGGCTGGGAGG + Intergenic
1123089741 14:105737241-105737263 CTGGCTGGCTGCGGGCTGGGAGG + Intergenic
1123095532 14:105765401-105765423 CTGGCTGGCTGCGGGCTGGGAGG + Intergenic
1123105771 14:105840438-105840460 GTGGCTGGCTGAGGGCTGGGCGG + Intergenic
1124005891 15:25795238-25795260 CTGTGTGGCTGTGGGCTGTGTGG - Intronic
1124239342 15:28017055-28017077 CTGGGGAGCGGGGGGCGGGGGGG + Intronic
1125109590 15:36015368-36015390 GTGGGTTGCGGGGGGCTGGCTGG - Intergenic
1126724076 15:51613022-51613044 CTGGCTGCCTGTGGGCTGGGTGG - Intronic
1127763788 15:62165329-62165351 TTGGGCCGCTGGCGGCTGGGCGG - Intergenic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1129115703 15:73364276-73364298 GTGGGTGTCTGGGGGCTGTGTGG - Intronic
1129260584 15:74365151-74365173 AGGGGTGGTTGGGGGCTGGGAGG - Intronic
1129539537 15:76339239-76339261 CTGGGCCTCTGGGTGCTGTGTGG + Intronic
1129710650 15:77818969-77818991 CTGGGGCGCGGCGGGCCGGGAGG - Intronic
1129945653 15:79537489-79537511 CTGGGTGGCTGGGGGCAGGTGGG + Intergenic
1130092326 15:80831303-80831325 ATGGGTGGCTGGGGGATTGGGGG + Intronic
1130133237 15:81160910-81160932 CTGGCTTGCTTGGGGCTGGCGGG + Intronic
1130207305 15:81889097-81889119 CTAGGTCGCTGGGCACTTGGAGG - Intergenic
1131277404 15:90994034-90994056 CTGAGACGCTGCGGGCGGGGAGG + Intronic
1132243710 15:100279009-100279031 CTGGGGCTGTGGTGGCTGGGAGG - Intronic
1133125191 16:3641826-3641848 CAGGGTGCCTGGGGGCTGGAAGG + Intronic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133280745 16:4663822-4663844 CTGGGGCCCTGGGGGCCGTGGGG + Intronic
1133342197 16:5044164-5044186 CAGGGTAGGTGGGGGCCGGGAGG - Exonic
1133420492 16:5642611-5642633 CTGGGTGGCTGGGGAAGGGGGGG - Intergenic
1133898564 16:9951982-9952004 CGGTATCGTTGGGGGCTGGGAGG - Intronic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134322745 16:13178601-13178623 CTGTGTTGCTGGGGACGGGGAGG - Intronic
1134785389 16:16937687-16937709 CTGGGTTGGTGGGGGTGGGGGGG + Intergenic
1135420176 16:22300523-22300545 CTGAGAGGCTGGGGCCTGGGAGG - Intronic
1136070052 16:27782288-27782310 TTGGGGCGCTGGGGGTCGGGGGG - Intergenic
1136229814 16:28879594-28879616 GAGGGTCTCTGGGGGCTGGCTGG + Intronic
1136349339 16:29696922-29696944 CTGGGGCGCAGGGAGCCGGGAGG - Intronic
1136355915 16:29744747-29744769 CACGGTGGCTGGGGTCTGGGCGG + Exonic
1136509106 16:30724859-30724881 CTGGGAAGCTGGGGACTGTGTGG - Exonic
1136579672 16:31143637-31143659 CTGGGTCTTCTGGGGCTGGGTGG + Exonic
1137618152 16:49858723-49858745 CTGGGCCGCGGGGGCGTGGGGGG - Intergenic
1137665262 16:50246027-50246049 GCGGGGGGCTGGGGGCTGGGGGG - Intergenic
1137742718 16:50795975-50795997 CTGGGTGGCTTGTGTCTGGGAGG + Intronic
1137863228 16:51867889-51867911 CTGGGTGGGTGGGGTGTGGGGGG + Intergenic
1138515431 16:57533326-57533348 CTGGTGTGCTGGGGGCGGGGTGG - Intronic
1139052738 16:63145739-63145761 CTGGGTGGAAGGGGTCTGGGTGG - Intergenic
1139516938 16:67457827-67457849 CTGGAACGCAGGCGGCTGGGTGG + Intronic
1139560372 16:67737962-67737984 CTGGGTTTCTGGGGGCTGACTGG - Intronic
1139570141 16:67806554-67806576 TTGTGTCACTGGGGGCGGGGAGG + Exonic
1141050155 16:80754326-80754348 ATGGCTTTCTGGGGGCTGGGTGG + Intronic
1141082087 16:81061488-81061510 CTGGGCCGCTGGGGAAGGGGAGG + Exonic
1141517527 16:84555825-84555847 TTGGGTAGCTGGGGGCTGGAGGG + Intergenic
1141926507 16:87173693-87173715 CTGGGCCGCCGTGGGCTGGAGGG + Intronic
1141990200 16:87604920-87604942 CTGGGGCGCTGAGGGCCGGGCGG + Intronic
1142142705 16:88479699-88479721 CTGGGTAGCAGGTGGGTGGGGGG - Intronic
1142347933 16:89565795-89565817 GTGGGTCACTGGGAGCTGAGAGG + Exonic
1142354761 16:89597149-89597171 CTGGGTCCATGGGGTCTGCGGGG + Exonic
1142356550 16:89604271-89604293 GGGGGTCACTGGGGGCTGGAGGG + Intergenic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142412854 16:89924934-89924956 AGGGGTCGCTGGGGGGAGGGAGG + Intronic
1142672195 17:1492385-1492407 CTGGGATGCTCTGGGCTGGGAGG - Intronic
1142690875 17:1605554-1605576 CTGGGGAGCTGGGTGGTGGGTGG + Intronic
1142690897 17:1605606-1605628 CTGGGGAGCTGGGTGGTGGGTGG + Intronic
1142762373 17:2050106-2050128 CCGGGTCCCTAGGGGCTGCGAGG - Intergenic
1142806072 17:2371974-2371996 CTGGGTGGTTGGGGGCCAGGCGG + Intronic
1143029724 17:3961192-3961214 ATGGGTGGCTGGGGACGGGGCGG + Intronic
1143382733 17:6506733-6506755 CAGGGACCCTGGGGCCTGGGAGG - Intronic
1143632823 17:8148604-8148626 CTGGCCTGGTGGGGGCTGGGAGG - Intronic
1144664302 17:17091536-17091558 CTGGGTGACTGGGGGCTGAATGG + Intronic
1144957619 17:19027121-19027143 CTGGGACCCTGGGGGCTGTGTGG + Intronic
1144966087 17:19078064-19078086 CTGAGTGGATGGGGACTGGGTGG + Intergenic
1144966093 17:19078079-19078101 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144966114 17:19078154-19078176 CTGGGTGGATGGGGACTGAGTGG + Intergenic
1144966125 17:19078184-19078206 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144966148 17:19078242-19078264 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144966165 17:19078286-19078308 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144966187 17:19078345-19078367 CTGGGTAGATGGGGACTGGGTGG + Intergenic
1144966194 17:19078360-19078382 CTGGGTGGGTGGGGACTGGGTGG + Intergenic
1144977537 17:19147395-19147417 CTGGGACCCTGGGGGCTGTGTGG - Intronic
1144981724 17:19173697-19173719 CTGGGTGGGTGGGGACTGGGTGG - Intergenic
1144981731 17:19173712-19173734 CTGGGTAGATGGGGACTGGGTGG - Intergenic
1144981753 17:19173771-19173793 CTGGGTGGATGGGGACTGGGTGG - Intergenic
1144981770 17:19173815-19173837 CTGGGTGGGTGGGGACTGGGTGG - Intergenic
1144981804 17:19173902-19173924 CTGGGTGGATGGGGACTGGGTGG - Intergenic
1144981821 17:19173946-19173968 CTGGGTGGATGGGGACTGGGTGG - Intergenic
1144981827 17:19173961-19173983 CTGGGTGGATGGGGACTGGGTGG - Intergenic
1144981844 17:19174005-19174027 CTGGGTGGATGGGGACTGGGTGG - Intergenic
1144981855 17:19174035-19174057 CTGGGTGGATGGGGACTGAGTGG - Intergenic
1144981875 17:19174110-19174132 CTGGGTGGATGGGGAGTGGGTGG - Intergenic
1144981881 17:19174125-19174147 CTGAGTGGATGGGGACTGGGTGG - Intergenic
1144986342 17:19204114-19204136 CTGAGTGGATGGGGACTGGGTGG + Intergenic
1144986348 17:19204129-19204151 CTGGGTGGATGGGGAGTGGGTGG + Intergenic
1144986369 17:19204204-19204226 CTGGGTGGATGGGGACTGAGTGG + Intergenic
1144986380 17:19204234-19204256 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144986397 17:19204278-19204300 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144986403 17:19204293-19204315 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144986420 17:19204337-19204359 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144986454 17:19204424-19204446 CTGGGTGGGTGGGGACTGGGTGG + Intergenic
1144986471 17:19204468-19204490 CTGGGTGGATGGGGACTGGGTGG + Intergenic
1144986493 17:19204527-19204549 CTGGGTAGATGGGGACTGGGTGG + Intergenic
1144986500 17:19204542-19204564 CTGGGTGGGTGGGGACTGGGTGG + Intergenic
1145049601 17:19648920-19648942 CGGGGGCGCTGGGGAGTGGGAGG - Exonic
1145272767 17:21413501-21413523 CTGGGTCCCTGTGGGCGGGGAGG + Intronic
1145310975 17:21700964-21700986 CTGGGTCCCTGTGGGCGGGGAGG + Intronic
1146054812 17:29575764-29575786 CAGGGTGGCTGGGGGCCGTGTGG - Intronic
1146664100 17:34685327-34685349 CTGGGGGGCTGGGGATTGGGTGG + Intergenic
1147250832 17:39151660-39151682 CTGGGTCGGTGGGGGTGGGGGGG + Intronic
1147868944 17:43573773-43573795 CAGGGTGGGTGGGGGCTGGGAGG + Intronic
1147946108 17:44080990-44081012 TTGGGAGGCTGAGGGCTGGGAGG + Intronic
1148441136 17:47712072-47712094 CTCTGTGGCTGGGGGCAGGGCGG + Intergenic
1148601725 17:48899280-48899302 CTGGGGCGGCGGGGGCGGGGGGG + Intergenic
1148688861 17:49515340-49515362 GTGGGTGGCTGGGAGCTGTGGGG - Intergenic
1148783915 17:50135945-50135967 GTACGTGGCTGGGGGCTGGGCGG - Intronic
1148797540 17:50204214-50204236 CTGGGGGGATGGGGGGTGGGAGG + Intergenic
1148818576 17:50347222-50347244 CAGGGGCGCTGGGGGCAGGGAGG - Intronic
1149506238 17:57196203-57196225 CAGGTTGGCTGGGGGCTGGCTGG + Intergenic
1149532761 17:57408583-57408605 CTGGGTGGGTAGGGGCGGGGGGG + Intronic
1149591748 17:57835118-57835140 CTGGGATGTTGGGGGCTGGCAGG - Exonic
1149638965 17:58191049-58191071 CTGGCTCCCTGAGGGCCGGGAGG + Intergenic
1149862320 17:60128948-60128970 CTGGGACCCTGGGAGGTGGGGGG - Intergenic
1150133888 17:62684330-62684352 CTGGGACGCTGAGCACTGGGAGG + Intronic
1150223085 17:63508115-63508137 GAGGGTGGTTGGGGGCTGGGAGG - Intronic
1150489043 17:65561774-65561796 CGGGGCCGCGGGGGGCTGGCAGG - Intronic
1150807716 17:68332288-68332310 CTGGCTGCCTGTGGGCTGGGCGG - Intronic
1151426668 17:74035196-74035218 CTCCGTGGCTGTGGGCTGGGTGG - Intergenic
1151681489 17:75625006-75625028 GTGGGTCTGTGGTGGCTGGGGGG + Intergenic
1151820470 17:76494116-76494138 GTGTGTTGCGGGGGGCTGGGGGG + Intronic
1151969472 17:77450439-77450461 AGGGCTTGCTGGGGGCTGGGAGG - Intronic
1152228865 17:79104859-79104881 CAGGGTCCCGGGGGCCTGGGCGG - Intronic
1152231179 17:79114812-79114834 CTGGGGCTCTGGGGGGTGGGTGG + Intronic
1152382467 17:79949207-79949229 CTGGGACGCTGGAGACTGTGAGG - Intronic
1152443507 17:80325675-80325697 CTGGGGCGCGGGGGGCTGGGGGG - Intronic
1152553895 17:81043496-81043518 CTGGGGTGCTGGGGCCTGGGCGG + Intronic
1152699027 17:81810219-81810241 CTGGGACCCAGGGGCCTGGGAGG + Intronic
1152720897 17:81923406-81923428 CTGGTTCTCTAGGGGCAGGGTGG - Intronic
1152855428 17:82662788-82662810 CTGGGCAGCTGGGGTCAGGGAGG + Intronic
1154297303 18:13162190-13162212 CTGGCTGTCTGGGGGGTGGGAGG - Intergenic
1154416731 18:14179302-14179324 CTGGGTCGGCGGGGGCGTGGGGG + Intergenic
1156384216 18:36591410-36591432 AAGGGAGGCTGGGGGCTGGGAGG + Intronic
1156669890 18:39455509-39455531 CTGGGTTGCTGGGGGCTGACTGG - Intergenic
1156865694 18:41886447-41886469 GTGAGAGGCTGGGGGCTGGGGGG + Intergenic
1157212901 18:45759213-45759235 ATGGGGCGGTGGGGGGTGGGTGG - Intergenic
1157451874 18:47795189-47795211 CTGGGGCACTCGGGGTTGGGCGG + Intergenic
1157521602 18:48349109-48349131 CTGGCTGGCTGGTGGCTGGCAGG + Intronic
1158965383 18:62617874-62617896 GTGGGTTGCCAGGGGCTGGGTGG + Intergenic
1158995311 18:62912501-62912523 TGGGGTTGCTGGGGGGTGGGAGG - Intronic
1159798488 18:72869164-72869186 CGGGGTCGCCGGGGGGCGGGGGG + Intergenic
1160168301 18:76532101-76532123 CTGGGTGGGTGGGTCCTGGGTGG + Intergenic
1160272888 18:77403696-77403718 CTGGGACCCTGGGGGAGGGGTGG + Intergenic
1160317515 18:77860809-77860831 CTGGCTCTCTGCAGGCTGGGTGG + Intergenic
1160659203 19:290692-290714 CGGGGTGGCGGGGGGCCGGGAGG - Intronic
1160702957 19:517402-517424 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160702982 19:517453-517475 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703023 19:517546-517568 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703039 19:517577-517599 CAGGATGGGTGGGGGCTGGGAGG + Intronic
1160703079 19:517670-517692 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703167 19:517876-517898 CAGGCTGGGTGGGGGCTGGGAGG + Intronic
1160703238 19:518068-518090 CTGGCTGGGTGGGTGCTGGGAGG + Intronic
1160733194 19:650176-650198 CTGGGTCCCTGGTGAGTGGGTGG - Intronic
1160747136 19:717318-717340 CTGGCTCCCCGAGGGCTGGGGGG - Intronic
1160789866 19:918396-918418 CAGGGGCGCTGGGGGAGGGGGGG + Intronic
1160865159 19:1253028-1253050 CTGGGTTGGGGGGGGCTGGAGGG + Intronic
1161102208 19:2426783-2426805 CTGGCTGGCAGGGGGCAGGGCGG + Exonic
1161219214 19:3110366-3110388 CTGGGCAGCTGTGGGCTTGGTGG + Intronic
1161224460 19:3136603-3136625 CAGGGTCGGTGGGCGGTGGGTGG + Intronic
1161328088 19:3672952-3672974 CTGGGGGGCTGGGGACTGGGGGG + Intronic
1161502326 19:4623186-4623208 CGGGGACACTGGGGGCGGGGTGG + Intergenic
1161518422 19:4710151-4710173 CTGGGTCACCGGGGCATGGGTGG - Intronic
1161571339 19:5032370-5032392 GTGGGTCACGGGGGGCTGGCTGG - Intronic
1161582089 19:5086649-5086671 CAGAGGCCCTGGGGGCTGGGGGG - Intronic
1161815778 19:6498999-6499021 CTGGGTGGCCAGGGGGTGGGAGG + Intronic
1161940922 19:7403363-7403385 CGTGGCTGCTGGGGGCTGGGAGG - Intronic
1161975895 19:7607642-7607664 TGGGGTCCCTTGGGGCTGGGAGG + Intronic
1162054833 19:8056274-8056296 GTGGGGCCGTGGGGGCTGGGGGG + Intronic
1162079030 19:8208219-8208241 CAGGGGCGCGGGGGGCGGGGCGG - Intronic
1162771804 19:12953686-12953708 CTGGGTCTTGGGGGGCTGGCTGG + Exonic
1163004392 19:14388564-14388586 CTGGGCTGAAGGGGGCTGGGCGG - Intronic
1163063071 19:14774170-14774192 CTGGGCTGAAGGGGGCTGGGCGG + Intronic
1163145925 19:15379374-15379396 CGGGGTCGCTGGGGGCCGGAAGG + Intronic
1163365237 19:16872388-16872410 ATGGGTGGCAGGTGGCTGGGTGG - Intronic
1163503293 19:17688421-17688443 CGGGGGCGCTGCGGGCTGGGGGG + Intergenic
1163548204 19:17951504-17951526 CTGGCTCGGTAGGGGATGGGAGG - Intronic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1163633811 19:18429455-18429477 GCGGGTCGCAGGGGGCGGGGGGG + Intronic
1163730590 19:18947090-18947112 CTGGGTGCCAGGTGGCTGGGCGG + Intergenic
1163764133 19:19153040-19153062 ATGGGTCCCTGGGGGGTGGACGG + Intronic
1163769247 19:19180686-19180708 CTGGGTTGGCGGAGGCTGGGGGG + Exonic
1164590428 19:29503900-29503922 CTGGGTAGCAGGGGGCTGTTGGG + Intergenic
1164788321 19:30955381-30955403 CAGGGTCGCTTGAGCCTGGGAGG + Intergenic
1165043449 19:33085333-33085355 CCTGGTTACTGGGGGCTGGGGGG - Intronic
1165104570 19:33461433-33461455 CTGGGACGCTGTGGGGAGGGAGG + Intronic
1165123855 19:33580549-33580571 CTGGCTCGCCAGGGGCTGGCAGG + Intergenic
1165394927 19:35558805-35558827 CTGGGTCCCTCAGGGTTGGGTGG - Intronic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
1165830665 19:38728780-38728802 CTGGGGCACTGGGGGCTTGGAGG + Intronic
1165862427 19:38916191-38916213 CTGTGCCGCTGGGGACGGGGTGG - Intronic
1166343135 19:42150533-42150555 CTGGATCGATCGGGGCTGGAGGG + Intronic
1166343404 19:42151439-42151461 CTGGGGAGTTGGGGGCTGGGGGG + Intronic
1166356152 19:42228862-42228884 CTGGGCTGCAGGGGCCTGGGAGG - Intergenic
1166453410 19:42919743-42919765 CTGGGTCTCACGGGGCTGGAAGG - Intronic
1166795485 19:45423223-45423245 CTGGGAGGCTGGGGGCTGTTAGG - Intronic
1166885683 19:45959667-45959689 ATGGGAGGCTGGGGGCGGGGTGG + Intronic
1166953784 19:46448118-46448140 CTGGGGAGCTGGGGGCCTGGAGG + Intergenic
1167017547 19:46850775-46850797 CGGGGCCGCTGGGGTCTGGACGG - Exonic
1167079015 19:47266585-47266607 CTGACTCCCTGTGGGCTGGGGGG + Intronic
1167125248 19:47544777-47544799 CTCGGGCGCAGGGAGCTGGGAGG + Exonic
1167148518 19:47696109-47696131 CAGGGGCACTGGGTGCTGGGCGG + Intronic
1167272021 19:48511307-48511329 GAGGGAGGCTGGGGGCTGGGTGG - Intronic
1167322101 19:48803436-48803458 GTGGATCGCTGGAGCCTGGGAGG + Intronic
1167519721 19:49946833-49946855 CGTGGTTGCTGGGGGCTAGGAGG + Intronic
1167559038 19:50214463-50214485 CTGGGACCCTTGGGGCAGGGAGG + Intronic
1167775027 19:51549122-51549144 CTGGGTGGCTGAGGGCTGCCAGG - Intergenic
1168110503 19:54189267-54189289 CAGGGTCTCTGCGGGCTGGCGGG - Intronic
1168325498 19:55536766-55536788 CTGGGTCGGAGGGAGGTGGGTGG - Intronic
1168353350 19:55688513-55688535 CTGGGCCCCTGGGGGATGGGAGG - Intronic
926125186 2:10267625-10267647 CTGGTTCCCTGGGAGCTGGGGGG + Intergenic
926195744 2:10762747-10762769 CTGGGTGGCTGGGTGGAGGGAGG - Intronic
926919149 2:17922666-17922688 AGTGGTTGCTGGGGGCTGGGGGG - Intronic
927513848 2:23660606-23660628 CTGGTGAGCTGGGGGCTGTGGGG - Intronic
927719547 2:25373840-25373862 CTGGGTCCCAGGGGGCTGTAAGG + Intergenic
927869091 2:26612533-26612555 CAGGGTCCCTGGTGGCTCGGAGG + Intronic
928065767 2:28163182-28163204 CAGGGTGGCTGCCGGCTGGGAGG - Intronic
929437665 2:41940701-41940723 CTGGGGCAGTGGGGGGTGGGGGG - Intronic
930700514 2:54455606-54455628 CTTGGGCGCTGGAGGATGGGTGG - Intergenic
931005291 2:57843623-57843645 CTGGTTGGCGGGGGGCGGGGGGG + Intergenic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931312618 2:61096479-61096501 CTAGGCAGCTGGGGGCTGGTGGG - Intronic
932459193 2:71871574-71871596 CTGGGCTGGTGGGGGGTGGGGGG + Intergenic
932776362 2:74530329-74530351 CGGTGGCGCTGGGCGCTGGGGGG + Exonic
933774015 2:85761016-85761038 CTGGGCTGTTGGGGGCTGAGGGG + Intronic
933790037 2:85876369-85876391 ATGGGTGGTTGGGGGCTGGAAGG + Intronic
934518662 2:95005707-95005729 CTGGGTCCCTGGAGGTGGGGTGG + Intergenic
935191435 2:100781780-100781802 CTGGAACCCTGGCGGCTGGGTGG - Intergenic
935626246 2:105174484-105174506 CATGGTGGATGGGGGCTGGGAGG + Intergenic
935686717 2:105690090-105690112 TTGGGTGGATGGGGGGTGGGTGG + Intergenic
935810778 2:106794863-106794885 CTGGCTCACTGGAGCCTGGGCGG + Intergenic
936012569 2:108934312-108934334 GTGGGCCACTGGGCGCTGGGGGG + Intronic
936284471 2:111171619-111171641 CCGGGGTGCTGGTGGCTGGGGGG - Intergenic
936581549 2:113704708-113704730 CTGGGTGGGTGTGGGCTCGGCGG - Intergenic
937181115 2:119997040-119997062 CTGGGTGGGTGTGGGCTCGGCGG + Intergenic
937239870 2:120453108-120453130 CTGGGTAGCTGTGAGCTGGGCGG + Intergenic
937904241 2:127045180-127045202 CTGGCGTGCTGGGTGCTGGGTGG - Intergenic
937915575 2:127097257-127097279 CTGGAGAGCTGGCGGCTGGGAGG - Intronic
938157458 2:128953299-128953321 ATGGGTGGCTGGGGGCGGGGAGG + Intergenic
938277146 2:130037138-130037160 CGGGGTCGCCGGGGGCTTCGGGG - Intergenic
938361833 2:130693567-130693589 CGGGGTCGCCGGGGGCTTCGGGG + Intergenic
938438238 2:131300251-131300273 CGGGGTCGCCGGGGGCTTCGGGG + Intronic
939902634 2:147868719-147868741 CAGGATCGCTTGGGCCTGGGAGG - Intronic
940885660 2:158987417-158987439 TTGGGTGGCTGGGGGGTAGGAGG + Intronic
942169210 2:173273506-173273528 CTGGGAAGCTGGGGGTTGGGTGG - Intergenic
942560394 2:177212922-177212944 CTGGTTCGGTGGGAGCGGGGAGG + Intronic
943369596 2:187001495-187001517 CTCGGGGGCTGGGGGCAGGGAGG + Intergenic
944581577 2:201137145-201137167 CTGGGGGGCTGGGGACAGGGAGG + Intronic
944955132 2:204799249-204799271 CTGGGTCGCTGGTGGCTGCAGGG + Intronic
945501302 2:210578814-210578836 TTGGGTTGTTGGGGGCTGGGGGG - Intronic
946173486 2:217909040-217909062 CTGGGTTGTTGGCGGCTGAGGGG - Intronic
947669741 2:231928680-231928702 CTGCTTAGCTGGGGCCTGGGAGG + Intergenic
947748501 2:232521433-232521455 CTGGGGCACGGGGGGCAGGGTGG - Intronic
947865787 2:233397194-233397216 CAGGGTGGCTGGGGGGGGGGGGG + Intronic
948101042 2:235373546-235373568 GTGGGGAGCTGGGGGGTGGGGGG - Intergenic
948268730 2:236657481-236657503 CAGGGAAACTGGGGGCTGGGGGG + Intergenic
948473837 2:238203761-238203783 CGGGGCGGCTGGGGGCGGGGCGG + Intergenic
948486677 2:238285720-238285742 CGGGGTAGATGGTGGCTGGGAGG - Intronic
948639624 2:239367075-239367097 CTGTGTGGCTGGGGGCCTGGGGG - Intronic
949027701 2:241774144-241774166 CTGGGGCCCTGGGGACAGGGAGG + Intergenic
949072631 2:242035184-242035206 CTGGGGCTCCCGGGGCTGGGCGG + Intergenic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1169141939 20:3231332-3231354 CTGGGTGTCTGTGGGCAGGGAGG + Exonic
1170587724 20:17747811-17747833 CTGGTCCCCTTGGGGCTGGGTGG - Intergenic
1171849204 20:30296070-30296092 CTGGGTGGTTGGGGAGTGGGAGG - Intergenic
1172130155 20:32650084-32650106 CTTGGTCCCTGAGTGCTGGGAGG - Intergenic
1172904475 20:38358658-38358680 GGGTGACGCTGGGGGCTGGGAGG - Intronic
1172944092 20:38674558-38674580 CCGGGGCTCTGGGGGCGGGGTGG - Intergenic
1173622921 20:44450220-44450242 CTGGGTAGCTGGGGTCGGGGTGG + Intergenic
1173881015 20:46412332-46412354 CTGGGACCCTGGGGGGTGGGAGG - Intronic
1174186218 20:48708211-48708233 CTGGGCCGCAGGGGGCCAGGAGG - Intronic
1174364560 20:50048626-50048648 CTGCGTCACTGAGAGCTGGGAGG + Intergenic
1174409083 20:50322037-50322059 CTGGAACGCAGGGAGCTGGGAGG + Intergenic
1175175476 20:57109256-57109278 CTGGCTCTGTGGGGACTGGGAGG - Intergenic
1175638580 20:60606711-60606733 CTGGGATGCAGGGGGCTGGCTGG - Intergenic
1175676528 20:60950717-60950739 ATGGGGCGCTTGGGGCTGAGTGG + Intergenic
1175731045 20:61354173-61354195 TTGGGCCTCTGGGGGGTGGGGGG - Intronic
1176158890 20:63638501-63638523 CTGGGTCTCTCGGGGTTGTGGGG + Intergenic
1176276923 20:64277941-64277963 CTGGGCAGCTGGGCACTGGGTGG + Intronic
1176276946 20:64278025-64278047 CTGGGCAGCTGGGCACTGGGTGG + Intronic
1176276966 20:64278107-64278129 CTGGGCAGCTGGGCACTGGGTGG + Intronic
1176276989 20:64278191-64278213 CTGGGCAGCTGGGCACTGGGTGG + Intronic
1178021021 21:28408296-28408318 CTGGTTTGCTGGGGCCTGGCTGG - Intergenic
1178690498 21:34746120-34746142 CTGGGACTCTGGGGGCAGCGTGG - Intergenic
1179162906 21:38912578-38912600 GTGGGTGCCGGGGGGCTGGGGGG + Intergenic
1179494681 21:41764139-41764161 CTAAGTGTCTGGGGGCTGGGCGG + Intronic
1179812249 21:43879527-43879549 CTGGGTGGCCGTGGGCTTGGAGG + Intronic
1179813090 21:43884678-43884700 CTGGGTGGCCTGGTGCTGGGTGG + Intronic
1179971267 21:44837627-44837649 CAGGGTGGCTGTGGGCTGGGGGG + Intergenic
1180062762 21:45393972-45393994 CTGGGTCGCAGTCGGCTGTGGGG + Intergenic
1180095467 21:45554000-45554022 ATGGGGCGCGGGGGACTGGGAGG - Intergenic
1180935943 22:19625526-19625548 CTGGGGTGCTCGGGGGTGGGGGG - Intergenic
1180946417 22:19696214-19696236 CTGGGGGGCTGGGGGCTGCGGGG - Intergenic
1181035839 22:20169386-20169408 CTGGGAGGCTGGGGGGTAGGAGG + Intergenic
1181466743 22:23114470-23114492 CTGGACCTCTGGGGGCTGAGGGG - Intronic
1181639647 22:24189868-24189890 CTGGGTGGCAGGAGGTTGGGAGG + Intergenic
1181671675 22:24428172-24428194 CTGGGGCCCTGGGTTCTGGGAGG + Intronic
1181870128 22:25891422-25891444 CTGGGACCCTTGGGGCTGGAAGG + Intronic
1182279151 22:29208214-29208236 CTGGGGTGCTGGGGTGTGGGTGG - Intronic
1182473065 22:30560568-30560590 CTGGGTCGCTGAGAAGTGGGAGG - Intronic
1183099599 22:35575624-35575646 GTGGGTGGCTGGGGTTTGGGGGG + Intergenic
1183454691 22:37916077-37916099 CTGGGACTCTGCGGGGTGGGTGG + Intronic
1183623258 22:38986925-38986947 CTGGGTGGCTGGGGACGGGGGGG + Intronic
1183720252 22:39558061-39558083 CAAGGTAGGTGGGGGCTGGGTGG + Intergenic
1184152948 22:42649146-42649168 GTGGGGCGCGGCGGGCTGGGCGG + Intronic
1184225825 22:43128367-43128389 CCGGGTGGCTGTGGGGTGGGAGG + Intronic
1184301104 22:43561540-43561562 CTGGGTGTGTGGGGGCGGGGCGG - Intronic
1184471277 22:44697716-44697738 CTGGAGCCCTGCGGGCTGGGCGG - Intronic
1184993840 22:48188264-48188286 CTGGGATGCTGAGGGATGGGAGG - Intergenic
1185049212 22:48545011-48545033 CTGAGCCACTGGGGGCTGGCTGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185335831 22:50270455-50270477 CTGGGTGGCCGGGGCGTGGGGGG + Intronic
1185346696 22:50313584-50313606 CTGGGGGGCACGGGGCTGGGGGG - Intronic
1185346814 22:50314014-50314036 CTCGGTGTCTGGGGGGTGGGTGG - Intronic
1185370166 22:50457196-50457218 CAGGCTCCCTGGGGGCTTGGTGG - Intronic
949556358 3:5156841-5156863 TTGGGAGGCTGGGGGCGGGGAGG - Intronic
950090663 3:10291948-10291970 CTGGGTGGCTTGGGGGAGGGTGG + Intronic
950116519 3:10454008-10454030 ATGGGTCGGTGGGTGGTGGGTGG - Intronic
950256677 3:11511899-11511921 CTGGGTGGGTGTGGGCTTGGTGG - Intronic
950469018 3:13173332-13173354 CTGGGTCTCTGGGGACAGGTGGG - Intergenic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
951131072 3:19045383-19045405 CTGGATTGGTAGGGGCTGGGAGG + Intergenic
951467732 3:23020309-23020331 CTGGGTACCTGGGAGCTGAGTGG + Intergenic
952076294 3:29701634-29701656 CTGGGTGGGCGTGGGCTGGGCGG + Intronic
952132195 3:30377609-30377631 ATGGGTAGCTGGGGGTTGAGGGG - Intergenic
952354247 3:32570297-32570319 CCGGGCCGCTGGGGGCCGGGCGG + Intronic
953407877 3:42668561-42668583 CTGGGTGGCTGTGGGATGGTGGG + Intergenic
954054758 3:48012655-48012677 GTGTGTGGCTGGGGGCGGGGTGG - Intronic
954111582 3:48436555-48436577 CTGGGCTGCTGGGGCCTGGATGG - Intronic
954144700 3:48628813-48628835 CTGGGGAGCAGAGGGCTGGGCGG - Intronic
954223025 3:49166112-49166134 TGGGGTCGCTGGGCGCGGGGTGG + Intronic
954317559 3:49809504-49809526 TTGGGACGCTGGGGGCTCAGGGG - Intronic
954590249 3:51776695-51776717 CTTGGTAGCTGGGGGCTGAATGG - Intergenic
954618887 3:51984522-51984544 CTTGGTGGCTAGGGCCTGGGAGG + Intronic
954739037 3:52732166-52732188 CTGTGAGGCTGGGCGCTGGGTGG - Intronic
954812424 3:53256178-53256200 CTGGGCCGCTGCGGACTGCGAGG + Intergenic
954886737 3:53881797-53881819 CCGGGACGCCGAGGGCTGGGAGG - Intronic
955043195 3:55336348-55336370 CTTGGCCCATGGGGGCTGGGTGG - Intergenic
955937291 3:64113650-64113672 AGTGGTGGCTGGGGGCTGGGTGG - Intronic
956832702 3:73069272-73069294 CAGGGTCGGGGGGGGTTGGGGGG - Intergenic
958035901 3:88170402-88170424 TTGGGAGGCTGGGGGGTGGGGGG + Intergenic
960656457 3:120009678-120009700 CAGGGTCTGTGGGGGGTGGGGGG + Intronic
961525817 3:127496728-127496750 CATGGTCGGTGGGGGCGGGGGGG - Intergenic
961548549 3:127652917-127652939 CTGGGTCACTGAGGGCAGGCTGG + Intronic
961554597 3:127689374-127689396 CTGGGTCGCTGCTGGAAGGGAGG + Exonic
961662928 3:128479930-128479952 CTTGGTTTCTGGGGGCTGGTTGG - Exonic
961754679 3:129121070-129121092 GTGGGTTGCTGGGGGGGGGGGGG - Intronic
962204053 3:133420733-133420755 CTGTGAGGCTGGGGGCTGAGAGG + Intronic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962758228 3:138484706-138484728 CTGGGTGGGTGTGGGCTTGGCGG + Intergenic
963637365 3:147815682-147815704 GTGGGGCGGTGGGGGCGGGGAGG + Intergenic
964129226 3:153268743-153268765 CTGGGTGGGTGTGGGCTCGGCGG + Intergenic
965558950 3:170043917-170043939 AGGGGTTGCTGGGGGCTGAGGGG - Intronic
965615214 3:170585853-170585875 CTGGGGCGCGGGGGGCGCGGAGG + Intronic
966594940 3:181717388-181717410 CTGGGCTGGTGGGGGGTGGGGGG + Intergenic
966596406 3:181727693-181727715 CAGGGTGGTTGGGGGCAGGGAGG - Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
967938308 3:194746977-194746999 GTGGGTATCTGGGGGCAGGGAGG + Intergenic
1202741783 3_GL000221v1_random:62855-62877 CTGGGTCTGCGGGGGCAGGGGGG - Intergenic
968522931 4:1042388-1042410 GTGGGTTGGTGGGGGTTGGGTGG - Intergenic
968555413 4:1244338-1244360 GTGGGTCTCTGGGCACTGGGGGG + Intronic
968585633 4:1414808-1414830 GGGGGTCGCTGCGGGGTGGGCGG - Intergenic
968658679 4:1789778-1789800 CTGGCTTGCTGGGGCCTGCGTGG - Intergenic
969053504 4:4387921-4387943 CTGGATCGCGGGATGCTGGGCGG + Intronic
969309551 4:6345564-6345586 CTTGGCCGCTGTGGGCTGGGAGG + Intronic
969873315 4:10117666-10117688 TTGGGGCTCTGGGGGCTGGGAGG + Intergenic
969873435 4:10118474-10118496 TTGGGGCTCTGGGGGCTAGGAGG + Intergenic
971137796 4:23888837-23888859 CTGGGTAGCTGGGGGCACGTAGG - Intronic
971214016 4:24647087-24647109 CTGGGCAGCTGGGGGCTGGCTGG + Intergenic
972829694 4:42801124-42801146 TTGGGAGGCTGGGGGCAGGGAGG - Intergenic
973144276 4:46805095-46805117 CTGGGTGGGTGTGGGCTTGGCGG - Intronic
973531991 4:51843788-51843810 CTGGTTGGCGGGGGGGTGGGGGG + Intronic
974839363 4:67283123-67283145 CTGGGTGGGTGCGGGCTTGGTGG - Intergenic
975064757 4:70047273-70047295 TGGGGTGGGTGGGGGCTGGGGGG - Intergenic
975754804 4:77561945-77561967 CTGGGTGGGTGTGGGCTTGGTGG + Intronic
976669506 4:87636465-87636487 CTGGGACGCTGGAGGTTGGTGGG + Intergenic
976693664 4:87895289-87895311 CAGGGCCTGTGGGGGCTGGGGGG + Intergenic
979351654 4:119650595-119650617 CTGGGCCGCTGGAGGCCGAGAGG - Intergenic
979865196 4:125745049-125745071 CTGGGTGGGTGCGGGCTCGGCGG + Intergenic
982880906 4:160714035-160714057 CAGGGTCTCTCGGGGGTGGGGGG + Intergenic
984860127 4:184230447-184230469 CTGGCTGGCCGGGGGCTGGCAGG - Intergenic
984883325 4:184429178-184429200 CTGGGGACCAGGGGGCTGGGGGG + Intronic
984965827 4:185138898-185138920 CTTGGTTGCTGGAGGCAGGGAGG - Intergenic
985472563 5:54614-54636 GGGGGTCGCTGGGAGGTGGGGGG + Intergenic
985573572 5:663509-663531 ATGGTCCGCTGAGGGCTGGGGGG - Exonic
985635938 5:1035925-1035947 CTGGGTGGCTGGGGTGTGGCTGG + Intronic
985744205 5:1637270-1637292 CTGGGTCACTGGAGGCTGCCCGG - Intergenic
985838910 5:2291120-2291142 CTGGGTGATTGGGAGCTGGGCGG - Intergenic
986140692 5:5026737-5026759 CTGAGCCTCTGGGGGATGGGTGG + Intergenic
986362546 5:6994371-6994393 CAGGGTGGCTGTGGGCAGGGAGG - Intergenic
987076437 5:14386322-14386344 TTGGGTGGCTAGGGGCTGGCTGG + Intronic
987108618 5:14664569-14664591 CTGAGTCGCCGGGGCCTGGAGGG - Intergenic
987128830 5:14841746-14841768 GGGGGTTGCTGGGGGCTTGGCGG - Intronic
987132953 5:14875704-14875726 AGGGGTCGGTGGGGGGTGGGGGG - Intergenic
987804059 5:22739719-22739741 GTGGGTTGCCAGGGGCTGGGAGG - Intronic
989593913 5:43138065-43138087 ACGGGTTGCTAGGGGCTGGGAGG + Intronic
989771500 5:45151902-45151924 CTGGCTGCCTGTGGGCTGGGCGG + Intergenic
989956825 5:50369496-50369518 CTGGGTGGGTGTGGGCTTGGTGG + Intergenic
989957908 5:50376890-50376912 CTGGGTGGGTGTGGGCTTGGCGG + Intergenic
990207635 5:53446828-53446850 CGGGGTGGGGGGGGGCTGGGGGG + Intergenic
990278850 5:54228487-54228509 CTGGGTGGGTGGGGGTGGGGGGG - Intronic
990649922 5:57886916-57886938 CTGTCTCGCAGGGGGCAGGGGGG - Intergenic
992277039 5:75131081-75131103 CTGGGTGGGTGTGGGCTCGGTGG - Intronic
997583104 5:135029347-135029369 CAGGGCCGCTGCGGGCCGGGAGG + Intronic
998156221 5:139788541-139788563 CTGGGTTGATGGGGGTTAGGGGG - Intergenic
998936515 5:147234953-147234975 CGGGGTAGCTGTGCGCTGGGCGG + Exonic
999947927 5:156617726-156617748 CTGGGTGGCTGGGTGCTGTTGGG - Intronic
1000046270 5:157524283-157524305 CTGGGGCCCAGGAGGCTGGGTGG + Intronic
1001641203 5:173245436-173245458 CAGGGACGCTGGGGGCGGCGAGG - Intergenic
1002283830 5:178149231-178149253 CAGGGTAGATGGGGGCTGTGAGG - Exonic
1002290406 5:178196544-178196566 CGGGGTGGCTGGGGGCCTGGGGG + Intergenic
1002451461 5:179321409-179321431 CAGGGTCGCTGGGGAGTTGGTGG - Intronic
1002616425 5:180459230-180459252 CTGGGTGGGCGCGGGCTGGGTGG + Intergenic
1002695668 5:181086691-181086713 CTGGGGAGCTGGGGGCAGCGGGG + Intergenic
1002817548 6:693902-693924 GTGGGATGCTGGGGGTTGGGGGG + Intergenic
1003421659 6:5963784-5963806 CAGGGTAGCTGGAGTCTGGGTGG - Intergenic
1004270020 6:14186780-14186802 CGGGGTGGGTGGGGGATGGGGGG - Intergenic
1004731797 6:18366366-18366388 CTGGGGGGCTGAGGGCAGGGAGG + Intergenic
1005569070 6:27127017-27127039 CTGGGCGGCTGGGGGCTGTTGGG + Intronic
1005866814 6:29943207-29943229 CCGGGTTGGTCGGGGCTGGGCGG + Intronic
1005999779 6:30955856-30955878 CCTGGGGGCTGGGGGCTGGGAGG - Intergenic
1006183669 6:32168551-32168573 CAGGGCTGCAGGGGGCTGGGTGG + Exonic
1006470766 6:34227423-34227445 GTGGGTAGCTGGGGGAGGGGAGG - Intergenic
1006598675 6:35211890-35211912 CCGGGTCCCTGGGGGGTTGGAGG - Intergenic
1006614614 6:35318011-35318033 CTAGGTGGCTTGGGTCTGGGTGG + Intronic
1006637168 6:35469046-35469068 CGGGGGCACTGAGGGCTGGGTGG - Intronic
1006646907 6:35521186-35521208 CTGGGTCCTTGGGGGCTTGGAGG - Intergenic
1006717678 6:36130711-36130733 CTGGGCCGCTGGGGGGCGGGGGG + Intronic
1007053552 6:38858495-38858517 CTGGGTTGCAGGGGGATGGACGG - Intronic
1007957397 6:45929982-45930004 CACGGGGGCTGGGGGCTGGGAGG + Intronic
1009871073 6:69452412-69452434 CTGAGTCTGTGGGGGCAGGGGGG + Intergenic
1010404179 6:75483868-75483890 CCTGCTTGCTGGGGGCTGGGGGG + Intronic
1013170790 6:107634941-107634963 CTGGGTCGCCGGCGGCGGGCGGG - Exonic
1014088399 6:117373588-117373610 CTGGGTGGGTGCGGGCTTGGCGG - Intronic
1014240718 6:119015382-119015404 CTGGGTGGGTGTGGGCTTGGCGG + Intronic
1014377050 6:120689221-120689243 CTGGGAAGCTCGGAGCTGGGTGG + Intergenic
1015002740 6:128239344-128239366 CTAGGGTGCTAGGGGCTGGGAGG - Intronic
1015206469 6:130645121-130645143 CTGGCTGCCTGTGGGCTGGGTGG - Intergenic
1015541413 6:134317796-134317818 CCAGGTAGCTGGGGGCGGGGAGG - Exonic
1016461538 6:144284866-144284888 CCGGGCTGCTGCGGGCTGGGAGG + Intergenic
1016502818 6:144741588-144741610 ATGGGTCACTGGGGGCAGGCAGG - Intronic
1017005774 6:150027299-150027321 CTGAGTGGCTGGGGGCAGTGTGG - Intergenic
1017012143 6:150070084-150070106 CTGAGTGGCTGGGGCCTGAGTGG - Intergenic
1017067505 6:150542984-150543006 CTGAGTTGCTGGGGACTGAGGGG - Intergenic
1019303019 7:318500-318522 CAGAGCCGCTGGGTGCTGGGTGG - Intergenic
1019314683 7:379034-379056 CTGGGTCGCAGGGGTCTCTGGGG + Intergenic
1019414639 7:921732-921754 ATGGGACGCTGGGTGCTAGGGGG - Intronic
1019507035 7:1396699-1396721 CTGGGTGGCTGGGGACAGAGTGG - Intergenic
1019618097 7:1975689-1975711 CTGGGTCCCTGGGGTGTGAGTGG + Intronic
1019774276 7:2903182-2903204 GTGGCTGGCTGGGGGCTGGGTGG - Intergenic
1020000024 7:4750257-4750279 CTGGGCAGCTAGGGACTGGGGGG + Intronic
1020073127 7:5240448-5240470 CTGTGTCCTTGGGGGCTGGGCGG + Intergenic
1020094674 7:5361746-5361768 CTGTGACGCTGGGGGGCGGGCGG + Intronic
1020103148 7:5406950-5406972 CAGGAACGCTGGGGGCTGGCAGG - Intronic
1020428432 7:8095245-8095267 GTGGGGGGCTGGGGGGTGGGGGG + Intergenic
1020615765 7:10458724-10458746 CTGGCTGCCTGTGGGCTGGGCGG - Intergenic
1021639748 7:22725964-22725986 CTGGGTCTCTGGAGACTGGAGGG + Exonic
1021794946 7:24245174-24245196 CTGGGTGTCTGGTGCCTGGGTGG + Intergenic
1022020889 7:26398556-26398578 CTCGGCGGCTGGGGGGTGGGCGG + Intergenic
1022467223 7:30660174-30660196 GAGGGTCACTGGGGGCTGAGGGG + Intronic
1022522985 7:31019789-31019811 GTGGGGCGGTGGGGGCTGTGGGG + Intergenic
1023221140 7:37920979-37921001 CTGGGTGCCTGGCTGCTGGGCGG + Exonic
1023700126 7:42883919-42883941 CTGAGTCTGTGGGGGCAGGGAGG + Intergenic
1023805351 7:43869262-43869284 CTGGGGGCCTGGGGGCCGGGGGG - Intronic
1023937206 7:44748681-44748703 CAGGGCCGCAGGTGGCTGGGCGG - Intronic
1023965389 7:44961213-44961235 CTGGGGGGCTGAGGGCTGAGGGG + Intergenic
1023965434 7:44961334-44961356 CTGGGGGGCTGAGGGCTGAGGGG + Intergenic
1024122779 7:46261664-46261686 CTGGCTGCCTGTGGGCTGGGTGG + Intergenic
1024648414 7:51386892-51386914 CAGGGCCGCTGGAAGCTGGGCGG + Intergenic
1024648946 7:51388965-51388987 CAGGGCCGCTGGAAGCTGGGCGG + Intergenic
1025052264 7:55741361-55741383 CAGGGCCACTGGGAGCTGGGCGG + Intergenic
1025129221 7:56367044-56367066 CAGGGCCACTGGGAGCTGGGCGG + Intergenic
1025749520 7:64281232-64281254 CTGGCTGCCTGTGGGCTGGGCGG - Intergenic
1026236123 7:68528743-68528765 CTGGGTGGGAGGGGTCTGGGCGG + Intergenic
1026808180 7:73441000-73441022 CAGTGTCGGTGGGGGGTGGGAGG - Exonic
1026979808 7:74519634-74519656 CCAGGTCGCTGGGGGCAAGGGGG - Exonic
1027674448 7:81141796-81141818 CTGGGTGGGTGTGGGCTCGGCGG + Intergenic
1028902637 7:96118540-96118562 CTGGGTTTCTTGAGGCTGGGTGG - Intergenic
1029202298 7:98847280-98847302 CTGGCTGGCAGGGGGCTGGATGG - Exonic
1030602633 7:111609597-111609619 CTGGTTCGCTCGGTGCTCGGTGG + Intergenic
1031288405 7:119901184-119901206 CTGTGTTGCCTGGGGCTGGGTGG + Intergenic
1031383731 7:121119831-121119853 TGTGGTTGCTGGGGGCTGGGAGG - Intronic
1031519573 7:122747203-122747225 GTGGGTGGCTGGGTGTTGGGGGG - Intronic
1032018138 7:128392636-128392658 CTGGGAGGCTAGGGGCAGGGAGG + Exonic
1032334406 7:131011634-131011656 CTGTGCTGCTGGGGCCTGGGAGG - Intergenic
1032703067 7:134398936-134398958 CTTGGTGGCTGGGGGGTGGGGGG - Intergenic
1033041373 7:137921858-137921880 CAGGATCGCTTGGGCCTGGGAGG - Intronic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1034460543 7:151195683-151195705 CGGGGTGGCCTGGGGCTGGGAGG + Intronic
1035527549 8:325573-325595 CTGGGGGGCTGGGGCCTGGGAGG - Intergenic
1035656613 8:1312516-1312538 CAGGGTTTCTGGGGGCTTGGGGG + Intergenic
1036196695 8:6723432-6723454 CGGGGTCGGTAGGGGCAGGGAGG - Intronic
1036649123 8:10630918-10630940 CTGGGCTTGTGGGGGCTGGGAGG + Intronic
1036998977 8:13695212-13695234 TTGGGCCACTGGGGGCTGTGTGG + Intergenic
1037542411 8:19885335-19885357 CTGAGTCTCTGGGGGCAGGGTGG - Intergenic
1039061281 8:33573961-33573983 CTGGGTGGATGTGGGCTTGGTGG + Intergenic
1039429489 8:37514740-37514762 CCGGGTCGCTGGTGACTTGGTGG + Intergenic
1039518451 8:38152081-38152103 CTGAGTCGCGGGGGGGCGGGGGG + Intergenic
1039608406 8:38901145-38901167 CCGGGGCGCCGCGGGCTGGGAGG - Intergenic
1039850548 8:41361086-41361108 CTGGGTTTCTGCGGGCTGGGCGG + Intergenic
1039873575 8:41567242-41567264 TTGGGTCGCTGGGGGTCAGGTGG - Intergenic
1040850690 8:51898637-51898659 CGGGGTCCCTGGGGCCGGGGAGG - Intronic
1040860924 8:51998786-51998808 CTGGGATGCTGGAGGCAGGGAGG + Intergenic
1043456544 8:80417727-80417749 CTGGGAGGCTGAGGCCTGGGAGG + Intergenic
1043621053 8:82192552-82192574 CTGGGTGGGCGCGGGCTGGGCGG - Intergenic
1044003484 8:86914017-86914039 CTGGCTGCCTGTGGGCTGGGTGG - Intronic
1044238251 8:89856656-89856678 CTATGTCACTGGGGGGTGGGGGG - Intergenic
1044674964 8:94719762-94719784 CTGGGGCGCCGGGGCCTGCGCGG - Intronic
1045335945 8:101205061-101205083 CTGGCTAGATGGGGGCTGCGTGG - Exonic
1045500469 8:102740681-102740703 CAGGTTCTCTGGGGGCTGGGTGG + Intergenic
1045776963 8:105815980-105816002 GTGGGTGGCTGGGGGTGGGGTGG - Intergenic
1046654115 8:116874416-116874438 CCGGGGCGAAGGGGGCTGGGCGG + Intronic
1046776255 8:118167178-118167200 GGGGGGCGCGGGGGGCTGGGGGG - Intergenic
1046932538 8:119855827-119855849 CCGGGTGGCTGCGGGCTTGGCGG + Exonic
1047214358 8:122864638-122864660 CTGGGGCCCTGGGGAGTGGGGGG - Intronic
1049217188 8:141413576-141413598 GTGGGAGGCTGGGGGCAGGGAGG + Intronic
1049539598 8:143202060-143202082 CTGGGTAGCGGGGAGCTGGCAGG - Intergenic
1049543467 8:143218846-143218868 CAGGGAGACTGGGGGCTGGGGGG + Intergenic
1049554930 8:143277045-143277067 CGGGGTCCCTGGGGTCTGGCGGG + Intergenic
1049682841 8:143927381-143927403 TTGGGTCGGTGGGGACGGGGCGG - Intronic
1049708682 8:144054146-144054168 CTGAGTCACTGGGTGGTGGGTGG - Intronic
1049775004 8:144400078-144400100 CTGGGTGCCTGTGGGGTGGGTGG + Exonic
1049777428 8:144413182-144413204 CGGGGCCGCACGGGGCTGGGAGG - Intronic
1049944528 9:581062-581084 CTGGGTAGGTGTGGGCTCGGCGG - Intronic
1050065910 9:1759305-1759327 CAGGTTGGCTGGGGGCTGGTGGG - Intergenic
1050077034 9:1876070-1876092 CTGGCCAGCTGGTGGCTGGGTGG + Intergenic
1051088596 9:13380450-13380472 CTGGGAGGCTGGAGGCTGGGGGG + Intergenic
1051833769 9:21311253-21311275 CTGGCTGCCTGTGGGCTGGGTGG + Intergenic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1052835842 9:33249370-33249392 CTGGGTGGCTAGGGTATGGGGGG - Intronic
1052989517 9:34511008-34511030 CAGGGTTGTTGGGGGCTGGAGGG - Intronic
1053424919 9:38004360-38004382 CTGAGCTGCTGGGGGCTGCGTGG + Intronic
1053786925 9:41658789-41658811 CTGGGTGGTTGGGGAGTGGGAGG - Intergenic
1054158138 9:61655406-61655428 CTGGGTGGTTGGGGAGTGGGAGG + Intergenic
1054161081 9:61672360-61672382 CTGGGACCCTGGGGGGTGGGGGG + Intergenic
1054477911 9:65586411-65586433 CTGGGTGGTTGGGGAGTGGGAGG + Intergenic
1055490246 9:76797674-76797696 CTTGGTTGCGGGGGGCAGGGTGG - Intronic
1055693422 9:78858013-78858035 CTGGCTGGCAGGGAGCTGGGCGG + Intergenic
1056585339 9:87924278-87924300 GTGGGGGGCGGGGGGCTGGGGGG + Intergenic
1056611542 9:88128662-88128684 GTGGGGGGCGGGGGGCTGGGGGG - Intergenic
1056793295 9:89639932-89639954 CTGGGACTCTTGGGGTTGGGAGG - Intergenic
1056858576 9:90158377-90158399 CTGCATCGCTTGGGGCTTGGTGG + Intergenic
1057195663 9:93114643-93114665 GGGGGTAGCTGGGCGCTGGGAGG - Intergenic
1057998702 9:99844005-99844027 TTGGGAGGCTGGGGGGTGGGGGG - Intronic
1058799347 9:108530203-108530225 CTGGGTGGCCGTGGGCTTGGCGG + Intergenic
1058893934 9:109383876-109383898 CTGAGGGGCTGGGGTCTGGGAGG - Intronic
1059305435 9:113349853-113349875 CTGGGGAGCCTGGGGCTGGGCGG + Intronic
1059305885 9:113352753-113352775 CTGGCTAGCTGGGGGGTTGGGGG + Intronic
1059538780 9:115110414-115110436 CTGGGTTGCTGGGGGCCAGTGGG + Intronic
1060402576 9:123357084-123357106 CTGGGTCCCTGTGGGGTGGCTGG + Intronic
1060487081 9:124054529-124054551 CAGGCTCTCTGGGAGCTGGGGGG + Intergenic
1060668094 9:125445130-125445152 CTGGGAGGATGGGGGCGGGGGGG + Intronic
1060816611 9:126638470-126638492 CTGGGACGTGGGGGGCCGGGTGG - Intronic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1060982685 9:127802856-127802878 CTGATTGGCTGGGGGCGGGGCGG + Exonic
1061087054 9:128405463-128405485 CTGGGGCGTGGGGGGCTGGCAGG - Intergenic
1061513685 9:131076265-131076287 CTGGGGCGCCGGGGCCAGGGGGG - Intronic
1061887890 9:133601963-133601985 CAGGGAAGCTGGGGGCTGGCAGG + Intergenic
1061929791 9:133826635-133826657 CTAGGTGGCTGGGGGAGGGGTGG - Intronic
1062003438 9:134228045-134228067 CTGTCTGGATGGGGGCTGGGAGG + Intergenic
1062057292 9:134475233-134475255 CTGGGCCTCAGGGGGCTGGGTGG + Intergenic
1062060937 9:134494666-134494688 CGGGGTGGATGGGGGGTGGGTGG + Intergenic
1062173538 9:135148454-135148476 CTGGGACACTGAGGGATGGGAGG - Intergenic
1062402914 9:136380262-136380284 CTGGGGGGTTGGGGGCAGGGTGG + Intronic
1062614447 9:137389685-137389707 CTGGGACGCTGGGAGCCAGGTGG + Intronic
1062688000 9:137826134-137826156 CTGGGTCCATAGGGGGTGGGTGG + Intronic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1185907750 X:3952116-3952138 CAGGTTGGCTGGGGGCTGGAGGG + Intergenic
1186829778 X:13378929-13378951 CGTCGTCGCTGGGGGCTGGCAGG + Intergenic
1187035839 X:15538355-15538377 CTGGTTTGCCTGGGGCTGGGAGG - Intronic
1187479754 X:19644215-19644237 AAGGGTAGTTGGGGGCTGGGGGG + Intronic
1188975100 X:36663229-36663251 AAGGGTAGTTGGGGGCTGGGGGG + Intergenic
1189137325 X:38562495-38562517 CAGGGCCGCGGGGGGCTGCGTGG + Intronic
1189294890 X:39911025-39911047 TGGGGGCGCTGAGGGCTGGGGGG - Intergenic
1189888896 X:45577886-45577908 TTGGGTCTCAGGGGGATGGGGGG + Intergenic
1190332042 X:49242152-49242174 CTGGGTGTCTGGGGTGTGGGCGG + Intronic
1190877501 X:54470352-54470374 CTGGGGCACTGGTGGCTGCGAGG + Exonic
1192033991 X:67544453-67544475 CTGGGCCGACGGGGGCGGGGGGG - Intronic
1192801150 X:74465895-74465917 CTCATTCCCTGGGGGCTGGGAGG - Intronic
1193384493 X:80854636-80854658 CTGGGTGACTGGGGGCTGAGTGG - Intergenic
1193533611 X:82686459-82686481 CTGAGTCCCTGGGGGAGGGGTGG - Intergenic
1195065152 X:101233401-101233423 CAGGGTGGCTGGGGGATGGCAGG - Intronic
1197658614 X:129145586-129145608 CTGAGTCCCTAGGGGCAGGGTGG + Intergenic
1197765486 X:130057118-130057140 GGGGGTGGCTGAGGGCTGGGAGG - Exonic
1198628346 X:138604930-138604952 TTGGGAGGCTGGGGGGTGGGGGG + Intergenic
1199193775 X:145003179-145003201 CTGGGTTACTGGGGGCAGGGTGG - Intergenic
1199680804 X:150223384-150223406 CTGGGGCTATGGGGGCAGGGAGG - Intergenic
1199855623 X:151756627-151756649 TTGGGATGCTGGGAGCTGGGAGG - Intergenic
1199858458 X:151779128-151779150 GTGGGGTGGTGGGGGCTGGGGGG + Intergenic
1200150652 X:153949863-153949885 CTGGGGCTCTGGGACCTGGGAGG - Intronic
1200242532 X:154505266-154505288 ATGGGAAGCTGGGGGCTGGCAGG + Intergenic
1200376907 X:155791631-155791653 AAGGGTAGCTGGGGGTTGGGAGG + Intergenic
1200519725 Y:4195752-4195774 CTGGGTGGGTGCGGGCTTGGCGG - Intergenic
1200725862 Y:6667062-6667084 CCGGGTGGGTGGGGGCTTGGTGG - Intergenic
1201147124 Y:11071038-11071060 TTGGGTGGGTGGGGGGTGGGGGG + Intergenic