ID: 1060970016

View in Genome Browser
Species Human (GRCh38)
Location 9:127732503-127732525
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060970005_1060970016 10 Left 1060970005 9:127732470-127732492 CCGGGTCAGTGGGCAAAGCATGA 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1060970016 9:127732503-127732525 GAGCCTGGCCCCTGGGTGTGGGG 0: 1
1: 0
2: 4
3: 49
4: 391
1060970002_1060970016 25 Left 1060970002 9:127732455-127732477 CCAGGCTCAGAACTGCCGGGTCA 0: 1
1: 0
2: 2
3: 11
4: 149
Right 1060970016 9:127732503-127732525 GAGCCTGGCCCCTGGGTGTGGGG 0: 1
1: 0
2: 4
3: 49
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type