ID: 1060970043

View in Genome Browser
Species Human (GRCh38)
Location 9:127732609-127732631
Sequence CCTGCAGGAGGATCTCCTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060970035_1060970043 10 Left 1060970035 9:127732576-127732598 CCAGCACCGCGCGGGAGATGACC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG 0: 1
1: 0
2: 1
3: 20
4: 168
1060970037_1060970043 4 Left 1060970037 9:127732582-127732604 CCGCGCGGGAGATGACCGGCTCC 0: 1
1: 0
2: 0
3: 3
4: 59
Right 1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG 0: 1
1: 0
2: 1
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060970043 Original CRISPR CCTGCAGGAGGATCTCCTCG CGG Exonic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900427939 1:2588974-2588996 CCTGCAGGATGTGCTCCTTGGGG - Exonic
901908996 1:12439189-12439211 CCTGCAGGAGGCTGACCTCGTGG - Intronic
902437753 1:16409282-16409304 CCTGCAGGAGGAGGTCGTGGGGG + Intronic
902955600 1:19922582-19922604 CCTGCAGGGGGACCTCCATGGGG - Intronic
904810661 1:33161520-33161542 CCTGCAGGAAGAACTGCTGGCGG + Intronic
905693669 1:39960206-39960228 CCTGAAGCAGGATGTCCTGGAGG - Intronic
906032639 1:42733626-42733648 ACTGCAGGAGTTTCTCCTCTGGG - Exonic
909498098 1:76302337-76302359 CCTGCATGAGTATCTGCTTGTGG + Intronic
912174640 1:107141106-107141128 CTTGCAGGAGGCTCCCCCCGGGG + Exonic
913345882 1:117810729-117810751 CCTGCAGGAAGAACTCCAGGAGG - Intergenic
917749422 1:178040746-178040768 GTTGCAGGTGGATCTCCTCAAGG - Intergenic
919878299 1:201886460-201886482 CCAGTAGGAGGTTCTCCTCAGGG - Intergenic
920831394 1:209469041-209469063 CATGCAGGTGGATCTTCTCCTGG - Intergenic
920832899 1:209481309-209481331 GCTGCAGGTGGAGCTCCTGGTGG + Intergenic
923281334 1:232445684-232445706 CCTTCAGGAGGAACACCACGTGG - Exonic
1069175336 10:65283092-65283114 CATGCAGGTGGATTTCCTCCTGG + Intergenic
1070617853 10:77982652-77982674 CCTGAAAGAGGATCTCCCCAAGG - Exonic
1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG + Intergenic
1074546128 10:114403801-114403823 CCGGCAGGTGGAGCTCCTGGAGG - Intronic
1075081305 10:119385712-119385734 GCTGCAGGAGGGTCACCTTGTGG + Intronic
1075716847 10:124560734-124560756 CCTGCCGGAGGAGCCCCTCTAGG + Intronic
1075953646 10:126504224-126504246 CCTGAAGCAGGAGCTCCTGGAGG - Exonic
1076856268 10:133116836-133116858 CCTGGAGGAGTCTCTGCTCGAGG - Intronic
1077021862 11:420520-420542 CGTCCAGGCGGATCTCCACGAGG + Exonic
1077033165 11:479384-479406 CCTCCAGGAGCATCTGCTGGTGG + Intronic
1077220284 11:1412730-1412752 CAGGCAGGAGGATCCCCTCTGGG - Intronic
1078459162 11:11500261-11500283 CCTGCAGGAGGCTGGCCTCCCGG + Intronic
1079348299 11:19671860-19671882 CATGCAGGAGGAGCTCCTAAAGG - Intronic
1080217478 11:29861826-29861848 CCTTCAGAAGGTTCTCCTTGTGG - Intergenic
1082816677 11:57514218-57514240 CCTCCATGAGGGGCTCCTCGCGG - Intronic
1082961178 11:58920033-58920055 CCGGGAGGAGGATCTCCCAGAGG + Intronic
1083271450 11:61574934-61574956 CCTGCATGAGGCTCTGCACGAGG - Intronic
1083622289 11:64055192-64055214 CCTGCAGGAGGTGCTCCTCTGGG + Intronic
1084096981 11:66917911-66917933 CCTGCAGCAGGAGGTCCTCCTGG - Intronic
1085031004 11:73270813-73270835 CCTGGGGGAGGGTCTCCTCCAGG + Intronic
1086941726 11:92805146-92805168 ACTGCAGGAGGAAACCCTCGAGG + Exonic
1087479546 11:98681357-98681379 CCAGCAGGAGCATCTGCCCGGGG - Intergenic
1087633538 11:100677963-100677985 CCAGCAGGAGGATTACCTAGAGG + Intergenic
1089221564 11:116876294-116876316 CCTGAATGAGGATGTCCTCTTGG - Exonic
1096505717 12:52091303-52091325 TCTGCAGGGGGAGCTCCTGGGGG + Intergenic
1101619087 12:106366054-106366076 CCTGCCGGAGGCTCTTCTTGAGG + Intronic
1101994670 12:109516475-109516497 CCTTGAGGAGGATTTTCTCGTGG + Intronic
1102461081 12:113099967-113099989 CCTGCTGCTGGAACTCCTCGTGG + Exonic
1102962685 12:117102812-117102834 CCTCCAGGAGGAGGTCCTCTGGG - Intergenic
1104859961 12:131918660-131918682 CCTCCATGAGGGTCTCCTCAGGG - Exonic
1113821956 13:113221056-113221078 CCTTCAGGAGGGTCTCCTCTGGG - Intronic
1115665038 14:35535734-35535756 CGGGCAGGAGCAGCTCCTCGCGG - Exonic
1117507713 14:56419114-56419136 TCTGCAGGAGGATTTCCTCATGG - Intergenic
1118849359 14:69572554-69572576 CCAGCAGCAGGAGCTCCTCCTGG + Exonic
1119559458 14:75578664-75578686 CCTGCACAAGGAACGCCTCGTGG + Exonic
1122324646 14:100875021-100875043 CCAAGAGGAGGGTCTCCTCGAGG + Intergenic
1129267763 15:74403217-74403239 CCTGCAGAAGGGTTTCCTGGTGG - Intergenic
1130949534 15:88574511-88574533 CCTGCACGAGGCTCCCTTCGAGG - Intergenic
1132157350 15:99504922-99504944 CCTCCAGGAGGAGCTCCAGGAGG - Intergenic
1132479941 16:162379-162401 GCTGGAGGAGGGTCTCCTCCAGG + Intronic
1134106426 16:11488766-11488788 CCTGGCTGAGGATGTCCTCGGGG + Exonic
1140127524 16:72130630-72130652 ACTGCAGAAGGGTCTCCTCCTGG - Exonic
1141097725 16:81174803-81174825 CCAGCTGGAGGAGCTGCTCGGGG + Intergenic
1141138540 16:81482444-81482466 CCTGGAGGAGGAGCTCCTGGAGG + Intronic
1141828149 16:86495114-86495136 CCAGCAGGAGGGGCTCCGCGGGG + Intergenic
1142122953 16:88396349-88396371 CCTTCAAGAGGGTCTCCTCCAGG - Intergenic
1142122968 16:88396403-88396425 CCTTCAGGAGGGTCTCCTCCTGG - Intergenic
1142122986 16:88396457-88396479 CCTTCAGGAGGGTCTCCGCCCGG - Intergenic
1142122996 16:88396484-88396506 CCTTCATGAGGGTCTCCTCCCGG - Intergenic
1142123013 16:88396538-88396560 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123040 16:88396619-88396641 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123050 16:88396646-88396668 CCTTCAGGAGGGTCTCCGCCCGG - Intergenic
1142123085 16:88396754-88396776 CCTTCACGAGGGTCTCCTCCTGG - Intergenic
1142123107 16:88396835-88396857 CCTTCAGGAGGGTCTCCTCCAGG - Intergenic
1142123117 16:88396862-88396884 CCTTCAGGAGGGTGTCCTCCCGG - Intergenic
1142123144 16:88396943-88396965 CCTTCATGAGGGTCTCCTCCTGG - Intergenic
1142123152 16:88396970-88396992 CCTTCAGGAGGGTCTCCTCCTGG - Intergenic
1142123162 16:88396997-88397019 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123179 16:88397051-88397073 CCTTCAGAAGGGTCTCCTCCCGG - Intergenic
1142733648 17:1880185-1880207 CACACAGGAGGAGCTCCTCGTGG + Intronic
1143473412 17:7190326-7190348 CCTGCAGCGGGTGCTCCTCGAGG + Exonic
1152165102 17:78698819-78698841 CCTGCCGGAGGAGCTCCTCCGGG - Exonic
1152918201 17:83052549-83052571 CCTCCTGGAGGACCTCCTGGTGG - Intergenic
1152937112 17:83145649-83145671 CCTGCTGGAGGAACTCCATGTGG + Intergenic
1159990333 18:74899477-74899499 CCTGGAGGAGGATGTCCTTTAGG + Intronic
1160248215 18:77177971-77177993 CCTGCAGGAGGAGCTTCTTAAGG + Intergenic
1161711754 19:5852598-5852620 GTTGCAGGTGGATCTCCTCACGG - Intergenic
1163580289 19:18134843-18134865 CCTGGCGGAAGATCACCTCGGGG - Exonic
1165856293 19:38880870-38880892 CCTGAAGGTGGACCTCCTCCTGG - Exonic
1166570048 19:43789791-43789813 GATGCAGGAGGATCTCTTGGGGG - Intergenic
1166860771 19:45809733-45809755 CCTGCAGGAGTCTCTGCTCCCGG - Intronic
1167301505 19:48680491-48680513 ACTCCTGGAGGATCTCCTGGCGG - Intergenic
1167305061 19:48703436-48703458 ACTCCTGGAGGATCTCCTGGCGG - Exonic
1167510056 19:49891092-49891114 CCTGCAGGAATATCTTCTCGGGG - Exonic
1168245369 19:55110515-55110537 TCTGCAGGAGGTTTTCCTTGTGG + Intronic
1168282790 19:55314485-55314507 CTTGCAGAAGGAGCTGCTCGTGG - Intronic
1168307761 19:55444703-55444725 CCTGCAGGAGGAACCCCCCAGGG + Intergenic
929333487 2:40712474-40712496 CCTGCTGGCGGATCTCCCAGTGG - Intergenic
930089363 2:47520663-47520685 CCTGAAGGAGAATCTGCTGGGGG + Exonic
930674451 2:54185329-54185351 CCTGCAGCTAGATCTCCTCATGG - Intronic
930979688 2:57508537-57508559 CCTGCATCAGAATCTCCTGGAGG - Intergenic
937692611 2:124772914-124772936 CCTGCAGGGAGGTCTCCTTGAGG - Exonic
939189302 2:138897405-138897427 CCTGCACCAGGATCACCTCCTGG - Intergenic
940036297 2:149315378-149315400 CCTGCAGGGTGTTCTCCTCACGG + Intergenic
946821880 2:223638361-223638383 CCTGCATCAGAATCTCCTGGAGG + Intergenic
947908982 2:233789532-233789554 CCTGCTGGATGATGTCCTGGAGG - Exonic
948131993 2:235607735-235607757 CCTCCAGGAGGCTGCCCTCGAGG - Intronic
948847925 2:240691880-240691902 CCTGCAGGCACAGCTCCTCGGGG + Exonic
1169191197 20:3660157-3660179 CCTGCAGGAGGCTGTGCTCCGGG + Exonic
1170142095 20:13134622-13134644 CCTGCACCAGAATCTCCTGGAGG - Intronic
1174853123 20:54016070-54016092 CATGCAGAAGAATCTCCTCTGGG - Intronic
1175316835 20:58054630-58054652 GCTGAGGGAGGATCTCCTCGTGG - Intergenic
1175893873 20:62327516-62327538 CCTGCAGGCGCACCTCCTGGCGG + Exonic
1176913813 21:14600666-14600688 CCTACAGAAGGATTTCCTCTTGG + Intronic
1176933576 21:14842033-14842055 CCTGGAGGAGGAGCACCTGGCGG - Intergenic
1178631049 21:34261762-34261784 CCAGCAGGAGGATTTCCTGTTGG - Intergenic
1179539365 21:42074168-42074190 CCTGCAGGAGTCTCTGCTCCGGG + Intronic
1180081467 21:45489676-45489698 CCTGCAGGTGGGTATCCTGGGGG - Intronic
1181456702 22:23063999-23064021 CCTGCAGGAGGATGCCACCGAGG - Exonic
1183584113 22:38742321-38742343 CCTGAAGGAGGATTTCCGCAGGG - Exonic
1183694526 22:39414173-39414195 CCTGAAGGAAGACCTCCTGGAGG + Intronic
1184377618 22:44124590-44124612 CCTGTGGGAGGGTCTCCCCGTGG + Intronic
1184438822 22:44496684-44496706 ACGGAAGGAAGATCTCCTCGGGG + Exonic
1184685852 22:46096032-46096054 CCTGCAGGGGGATATCTCCGTGG + Intronic
949489528 3:4575142-4575164 CCTGCAAGAAGATCTCCTGGTGG + Intronic
950836125 3:15920674-15920696 CCTGCATCAGAATCTCCTGGAGG - Intergenic
952229364 3:31413930-31413952 CCTGCATCAGAATCACCTCGAGG - Intergenic
953805183 3:46062262-46062284 CCTGCAGCAGGGTCTCCTGAAGG - Intergenic
954155530 3:48682988-48683010 CCTGGAGCAGGATGTCCTCCAGG - Exonic
954685035 3:52365663-52365685 CCTGCAGGAGGAGCTCCTCTGGG + Intronic
955962912 3:64359062-64359084 CATGCAGGTGGATCTCCTGCTGG + Intronic
956798777 3:72738816-72738838 CCTGGAGGAGGGTCTCCCAGCGG - Intergenic
964369003 3:155979917-155979939 CCTGCTGGAGGCTCTTCTTGAGG + Intergenic
967621124 3:191635087-191635109 ACTGCAGGAGAATCTCGTCAAGG + Intergenic
968434915 4:579456-579478 CCCGCAGGAGGATGCCCTGGTGG + Intergenic
968477227 4:817734-817756 CCTGGAGGAGGAAATCCTCATGG - Intronic
972316304 4:37929502-37929524 CCTGCATCAGGATCACCTGGGGG - Intronic
979866557 4:125762529-125762551 AGTGCAGGATGATCTCCTCAAGG - Intergenic
982497109 4:156106937-156106959 CCTGCAGGAGGAGGTTCTGGAGG + Intergenic
984234756 4:177142427-177142449 CCTGCTGGGGCATCTCCTAGTGG + Intergenic
986932615 5:12845713-12845735 TCTGCAGGAGAAGCTCCTCCTGG - Intergenic
987292865 5:16524845-16524867 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292877 5:16524897-16524919 CCTGCAGGTGGATGTGCGCGGGG + Intronic
987292910 5:16525053-16525075 CCTGCAGGTGGATGTGCGCGGGG + Intronic
990565128 5:57020451-57020473 CCTGCAGGAGGAGGTCCTGTAGG + Intergenic
992303004 5:75404439-75404461 CCTGCAGGAGGAAGGCCTCTAGG - Intronic
992326597 5:75666004-75666026 TCTGCAGGAGGATTACCTGGAGG + Intronic
993332988 5:86622799-86622821 CTTGCGGGAGGACCTCCTTGTGG + Intergenic
994172088 5:96668957-96668979 CCTGCAGGAGGTGCTACTGGAGG + Intronic
994604696 5:101953051-101953073 TCTGCAGGAGTATTTCCTCTAGG + Intergenic
996179994 5:120407312-120407334 CCTACAGGAGCATCACCTAGCGG + Intergenic
998524788 5:142832444-142832466 CCTGCTGCAGGCTCTCCTCCTGG - Intronic
999101352 5:149028432-149028454 CCTGGAGGAGGAGCTCCTCTCGG - Exonic
1001100191 5:168807919-168807941 CCTGCAGGAGGATCCACCCTTGG - Intronic
1001926277 5:175639578-175639600 CGTGCAGGAGGCGCTCCTCTGGG + Intergenic
1002333972 5:178465523-178465545 CCACCAGGAGGGCCTCCTCGAGG - Intronic
1002853797 6:1020378-1020400 ACTGCAGGAGCAGCTCCTCCAGG + Intergenic
1006180400 6:32150568-32150590 CCTGCAGGAGACTCGCTTCGAGG - Exonic
1017002663 6:150006609-150006631 CCTGCTGGAGGCTCTCCTGCTGG - Intergenic
1019047637 6:169160918-169160940 CCTGGGGAAGGATCTCCTCCCGG + Intergenic
1019320327 7:412215-412237 GCTGCAGGAGCACCTCCCCGGGG - Intergenic
1019432792 7:1007228-1007250 CCTCCAGGAGGAACCCCTCGTGG + Intronic
1020125607 7:5531059-5531081 CCTGCAGAAGGAGCTCTTGGAGG + Intronic
1021830276 7:24600028-24600050 CCTGCCTGAGGATCTTCTTGCGG + Intronic
1023350931 7:39319598-39319620 CTTGCATGAGAATTTCCTCGGGG - Intronic
1029557713 7:101281928-101281950 CATGCAGGAGGGTCTGCTGGTGG + Intergenic
1031961724 7:127996062-127996084 CCTGCAGAATGAGCTCCCCGGGG - Intronic
1032450728 7:132028696-132028718 CCTGCATCAGAATCTCCTTGAGG - Intergenic
1035255904 7:157627174-157627196 CCTGCAGCTGGGTCTCCTCCGGG + Intronic
1035263229 7:157674821-157674843 CCGGCAGGAGGAGCTCGGCGTGG - Intronic
1036212684 8:6854923-6854945 ACTGCAGGAGGAGATCTTCGAGG + Intergenic
1036453849 8:8892008-8892030 CCTGCAGCACGAGCTCCTCCAGG + Exonic
1037817178 8:22118409-22118431 CCTCCGGGAGCATCTCCTCCAGG + Intronic
1038024450 8:23576247-23576269 CCTGCATGAGGCTCTGCTCATGG - Intergenic
1041628727 8:60060960-60060982 CCTGCAGCAGAATCTCTTGGTGG - Intergenic
1045293098 8:100850574-100850596 CCTGCAAGAGGATGTCCGTGGGG + Intergenic
1045368086 8:101494106-101494128 CCTTCAGGAAGGTCCCCTCGGGG - Intronic
1046180460 8:110639480-110639502 CCTGCAAGAGGAGCTCCACCAGG + Intergenic
1047556698 8:125939648-125939670 CCTGCAGCAGGATCTGCTTCTGG + Intergenic
1059410028 9:114125918-114125940 CCTGCAGAAGGAGCTCATTGAGG - Intergenic
1059505108 9:114791529-114791551 TCTGCAGGGGGATATCCTTGTGG - Intronic
1060970043 9:127732609-127732631 CCTGCAGGAGGATCTCCTCGCGG + Exonic
1062266527 9:135688984-135689006 CCTGCAGGATGCTCTCCTCACGG - Intergenic
1062314540 9:135960344-135960366 CCAGGAGTAGGGTCTCCTCGCGG - Intronic
1187358735 X:18604351-18604373 CCTGTAGGAGGGACTCCTAGAGG - Exonic
1190929353 X:54934814-54934836 CCTGCAGGAGGTTCCCTTAGTGG - Intronic
1192684301 X:73287662-73287684 CTTGCAGGAGTATCTCATTGTGG - Intergenic
1192706139 X:73529906-73529928 CCTGGGGGAGGATGTCCTGGAGG - Intergenic
1193372922 X:80720228-80720250 CCTCCAGGAGGACCTTCTTGAGG - Intronic
1199077188 X:143537120-143537142 CCTGCAGGAGGACATCCTAAAGG + Intergenic
1199550963 X:149060962-149060984 CCAGCATGAGGACCTCCTGGGGG - Intergenic
1200144825 X:153921117-153921139 GCTGCAGGATGAGCTCCTGGAGG - Exonic
1200787790 Y:7274581-7274603 CCTGCAGCGGGATCCCCGCGCGG + Intergenic