ID: 1060970885

View in Genome Browser
Species Human (GRCh38)
Location 9:127737198-127737220
Sequence GGGTCACAGCAGCAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060970885_1060970890 2 Left 1060970885 9:127737198-127737220 CCACTCTGCTGCTGCTGTGACCC No data
Right 1060970890 9:127737223-127737245 GAAAAGTCCCTTCTCCTTTCAGG No data
1060970885_1060970898 27 Left 1060970885 9:127737198-127737220 CCACTCTGCTGCTGCTGTGACCC No data
Right 1060970898 9:127737248-127737270 CCAGTCTTCAAGAGGGGAGTTGG No data
1060970885_1060970899 28 Left 1060970885 9:127737198-127737220 CCACTCTGCTGCTGCTGTGACCC No data
Right 1060970899 9:127737249-127737271 CAGTCTTCAAGAGGGGAGTTGGG No data
1060970885_1060970894 19 Left 1060970885 9:127737198-127737220 CCACTCTGCTGCTGCTGTGACCC No data
Right 1060970894 9:127737240-127737262 TTCAGGTACCAGTCTTCAAGAGG No data
1060970885_1060970896 21 Left 1060970885 9:127737198-127737220 CCACTCTGCTGCTGCTGTGACCC No data
Right 1060970896 9:127737242-127737264 CAGGTACCAGTCTTCAAGAGGGG No data
1060970885_1060970895 20 Left 1060970885 9:127737198-127737220 CCACTCTGCTGCTGCTGTGACCC No data
Right 1060970895 9:127737241-127737263 TCAGGTACCAGTCTTCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060970885 Original CRISPR GGGTCACAGCAGCAGCAGAG TGG (reversed) Intergenic
No off target data available for this crispr