ID: 1060971320

View in Genome Browser
Species Human (GRCh38)
Location 9:127739793-127739815
Sequence AGGGCTCAGGGCCCTCTGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 289}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060971308_1060971320 1 Left 1060971308 9:127739769-127739791 CCACGCCGTGCTCCGTGCTGCCC 0: 1
1: 0
2: 1
3: 28
4: 287
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289
1060971303_1060971320 25 Left 1060971303 9:127739745-127739767 CCTCCAGGTGAGCCAGCACCACC 0: 1
1: 0
2: 2
3: 39
4: 293
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289
1060971307_1060971320 4 Left 1060971307 9:127739766-127739788 CCTCCACGCCGTGCTCCGTGCTG 0: 1
1: 0
2: 2
3: 9
4: 155
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289
1060971305_1060971320 13 Left 1060971305 9:127739757-127739779 CCAGCACCACCTCCACGCCGTGC 0: 1
1: 0
2: 4
3: 25
4: 260
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289
1060971306_1060971320 7 Left 1060971306 9:127739763-127739785 CCACCTCCACGCCGTGCTCCGTG 0: 1
1: 0
2: 0
3: 13
4: 190
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289
1060971310_1060971320 -4 Left 1060971310 9:127739774-127739796 CCGTGCTCCGTGCTGCCCCAGGG 0: 1
1: 0
2: 3
3: 62
4: 493
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289
1060971304_1060971320 22 Left 1060971304 9:127739748-127739770 CCAGGTGAGCCAGCACCACCTCC 0: 1
1: 0
2: 0
3: 34
4: 346
Right 1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG 0: 1
1: 0
2: 4
3: 28
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060971320 Original CRISPR AGGGCTCAGGGCCCTCTGGT GGG Exonic
900381780 1:2387768-2387790 AGGGCAAAGGACCCTCTGGTCGG + Intronic
900531346 1:3155014-3155036 AGGCCTCAGGGCCCACAGGCAGG - Intronic
900627494 1:3615670-3615692 GTGGCTCAGGGCCCTCTTGCAGG - Intergenic
900939493 1:5788998-5789020 AGGGGTCAGGGCCAGCTGGAAGG + Intergenic
901415134 1:9111238-9111260 AGAGCTCAGGGCCCTCTGCATGG - Intronic
902691738 1:18114118-18114140 ATGGTTCATGGCCCTCTGGCTGG + Intronic
902717187 1:18280883-18280905 AGGGCTCAGGGTCCCCTTCTGGG + Intronic
902797738 1:18810323-18810345 AGGGCTGAGGGCCAGCTGCTGGG - Intergenic
902803895 1:18849104-18849126 GGGGCTCAGGGGCCTCTGCAAGG - Intronic
904279626 1:29409654-29409676 AGGCCTTGGGGCCCACTGGTTGG + Intergenic
905380537 1:37558626-37558648 AGCTGTCAGGGCCCTGTGGTAGG - Intronic
906112000 1:43330352-43330374 ATGACTCAGGGCCAACTGGTGGG - Intergenic
906214952 1:44033258-44033280 AGCGCTCAGTGCCCTCTTCTAGG - Intergenic
906240435 1:44239184-44239206 AGAACTCAGGGCCCTGTGGCAGG + Intronic
912947313 1:114095988-114096010 AGAGCTAAGAGGCCTCTGGTCGG - Intronic
913121491 1:115745247-115745269 AGGGCTCAGGGCCCCTTGTCAGG - Intronic
913713551 1:121511365-121511387 AGGGCTCAGGGCTCGCTTTTGGG - Intergenic
919753369 1:201052132-201052154 AGGGCGCAGGGGCCTATGCTTGG - Intronic
919774911 1:201188210-201188232 AGGGCTCAGGGACTTTGGGTAGG - Intergenic
919934905 1:202245107-202245129 GGGCCTTAGGGCCCTCTGGCTGG - Intronic
923433789 1:233949630-233949652 AGGGCTAAGGTCTCTCTGGACGG - Intronic
1062822910 10:548240-548262 AGGGCTCAGGGCCCCCAGGTGGG + Intronic
1064004894 10:11691687-11691709 AGGGCTCAGGGCTCTCAGGGAGG + Intergenic
1067470479 10:46534156-46534178 AGGGTTCAGTGCACTCTGTTCGG + Intergenic
1067561465 10:47307622-47307644 AGGGCTGAGCTCCCTCTGGCAGG + Intronic
1068557690 10:58477379-58477401 CCAGCTCAGGGCCCTCTGGCAGG + Intergenic
1069372588 10:67763684-67763706 AGGCCTCAGTGCCGTCAGGTGGG + Intergenic
1069662282 10:70131757-70131779 GGGGCTCAGTGCCCTCTTCTTGG + Intronic
1070777230 10:79116799-79116821 AGGGCACAGGGGGCTCTAGTGGG - Intronic
1073061802 10:100737748-100737770 AGGGCTCGGGGCCGTCTAGGGGG - Intronic
1073123271 10:101134588-101134610 AGGCTTCAGGGCTTTCTGGTTGG + Intronic
1073582901 10:104683857-104683879 TGGGCTCAGGGCTCTATGCTGGG + Intronic
1074780786 10:116800492-116800514 AAGGCTCAGTTCCCACTGGTGGG - Intergenic
1074859527 10:117499758-117499780 AGGGCTCTGGGCTCTCCAGTGGG + Intergenic
1076368611 10:129937392-129937414 AGGCCCCAGGGACCTCAGGTGGG + Intronic
1076519645 10:131073633-131073655 AGAGCCCAGGCCCCTCTGGATGG + Intergenic
1076575569 10:131464580-131464602 AGAACTCAGGGCCTTCTGATGGG - Intergenic
1077142621 11:1031134-1031156 AGGGCTGGGGGGCCTCTGGGGGG - Intronic
1077413255 11:2413240-2413262 AGAGCTCAGGGCCCGCAGGAAGG + Intronic
1078590048 11:12632717-12632739 AGGGGCCAGGGTCCTCTGGCAGG + Intergenic
1079356679 11:19735733-19735755 AGGGACCAGAGCCATCTGGTGGG + Intronic
1080231030 11:30017501-30017523 AGGGATCTGGGCGCTCTGGCAGG - Intergenic
1081712162 11:45224433-45224455 GGTGCTCAGGGCCAACTGGTGGG - Exonic
1081869609 11:46377342-46377364 AGGGCTGAAGGCCGTCAGGTGGG - Intronic
1083771445 11:64869912-64869934 AGGGCTCAGGACACACAGGTGGG + Intronic
1084428414 11:69097957-69097979 AGGGCTCAGGGCCACCTGGAGGG - Intergenic
1084477224 11:69395859-69395881 AGGGCTAAGGGGGCTCTGCTTGG - Intergenic
1086157517 11:83683889-83683911 AGGGCCCAGGGCTCTGTGCTGGG + Intronic
1088813124 11:113404837-113404859 GGAGCTCAGTGCCCTCAGGTTGG - Intergenic
1088916775 11:114233454-114233476 AGGGTGCAGGGGCCTCTGGCAGG - Intronic
1089323857 11:117644117-117644139 TGGGCTCAGGGCCGCCCGGTCGG + Intronic
1090037293 11:123260090-123260112 AGGGCTCAGTGCACTGTGGTAGG - Intergenic
1090069017 11:123527358-123527380 AGGGAACAGGGCCCTTTAGTGGG + Intronic
1090668318 11:128929792-128929814 CTGGCTCAGGGGCTTCTGGTAGG + Intergenic
1091887375 12:4026473-4026495 AGGGCTCAGGACTTTCTTGTTGG - Intergenic
1091900584 12:4141064-4141086 AGAGCTCAGGGGCCTGTGGGTGG + Intergenic
1092953967 12:13532381-13532403 ATGGCTCAGGGCCCACTGCAGGG + Intergenic
1094879492 12:34702583-34702605 AGGGCTTTGGGGCCTATGGTAGG + Intergenic
1098509208 12:71291932-71291954 AGGCCTGGGGTCCCTCTGGTTGG - Intronic
1100085821 12:90909245-90909267 AGGTCTCACTGCCCTCTAGTGGG + Intronic
1101724429 12:107377271-107377293 AGGCCTCAGGCCATTCTGGTGGG - Intronic
1102024343 12:109705087-109705109 ATGCCTCAGGGACCTCTAGTTGG - Intergenic
1102293729 12:111722513-111722535 AGGCCGCAGGGTCCTCTGCTAGG - Intronic
1102812807 12:115839058-115839080 AGAGCTCAGGGCCATCTGGAGGG + Intergenic
1104549939 12:129747127-129747149 TGGGCTCAGGGCCTTGTGGGCGG - Intronic
1104599443 12:130142512-130142534 AGGGCTCCGTTCCCTCTGGAAGG + Intergenic
1104814452 12:131637749-131637771 CAGGCTCAGGGCCCTGTGGGAGG + Intergenic
1105456291 13:20544283-20544305 AGGGCTTAAGGCCCTCTCTTTGG - Intergenic
1106587297 13:31068603-31068625 AAGGCTCATGGCCCTCTGAGGGG - Intergenic
1106735684 13:32586337-32586359 CGCGCTCGGGGCCGTCTGGTCGG + Intergenic
1107317663 13:39150941-39150963 AGGGCTCCAGGCTCTCTGCTAGG + Intergenic
1111969434 13:94895950-94895972 AGGGCCCAAGGCCCACAGGTTGG - Intergenic
1112363488 13:98738409-98738431 AGGCCTCTGGGCCCTGTGATGGG - Intronic
1113913795 13:113858030-113858052 AGGGCTCCGGCCCCTCAGGCAGG + Intronic
1117316299 14:54574123-54574145 AGGGCCCTGGGCTCTCTGCTGGG - Intronic
1118006049 14:61564889-61564911 AGGTCTCAGGTCTCTCTGGCTGG - Intronic
1118780091 14:69002170-69002192 AGGGCTCATGGACCTCTGGCAGG - Intergenic
1119480683 14:74955828-74955850 AGGGCTGTGGGCCCTGTGGGCGG - Intergenic
1121428503 14:93870799-93870821 AGAGCTCAGGCACTTCTGGTAGG + Intergenic
1122200829 14:100121606-100121628 AGGGGCCAGAGCCCTCTGGAAGG + Intronic
1122204054 14:100139527-100139549 AGGACCCAGGGCCCTCTGGCTGG + Intronic
1122402717 14:101476730-101476752 AGGGCTCTGGGCACTCGGCTGGG - Intergenic
1122611951 14:102990680-102990702 AGAGCTCAAGGCCCTTTAGTGGG - Intronic
1122637257 14:103135986-103136008 AGGGCTCAGGGCCCCATTGCAGG - Exonic
1122809552 14:104281264-104281286 AGGGCGCCAGGGCCTCTGGTTGG + Intergenic
1122855852 14:104559786-104559808 AGGGCTCAGCTCCCTCTAGTTGG - Intronic
1122953547 14:105059332-105059354 AGGGCTCTGGGCCAGCAGGTGGG + Intronic
1122953998 14:105061464-105061486 GGGGCTCAGGGCCCTCTCTCCGG + Intronic
1123439429 15:20280235-20280257 AGGACTCAGGTCCCACTGGGAGG + Intergenic
1124118149 15:26866971-26866993 AGGGCGCAGGGCCCCCGGCTCGG - Exonic
1124183032 15:27496161-27496183 AGCGCTCATGGCCATCTGGCAGG + Intronic
1125932178 15:43608183-43608205 AGGGCTCTGGGCACCCTGGCAGG - Exonic
1125945276 15:43707657-43707679 AGGGCTCTGGGCACCCTGGCAGG - Intergenic
1127728079 15:61770803-61770825 AGGGATGACAGCCCTCTGGTGGG - Intergenic
1128213406 15:65917571-65917593 AGGGTGCAGTGCCCTCTGGGTGG - Intronic
1128650718 15:69410806-69410828 GCGTCTCAGGGCCCTGTGGTGGG + Intergenic
1128764683 15:70243951-70243973 AAGGCTCAGGCCCCTCTGAGGGG + Intergenic
1129188030 15:73922501-73922523 TGGGCTCAGGGCCCCCGGGTTGG + Intergenic
1129459944 15:75695512-75695534 AGGCCTCAGAGGCCTCTGTTGGG - Intronic
1130052517 15:80495701-80495723 AGGGCTCTGTGCCCTGGGGTTGG + Intronic
1132154688 15:99487119-99487141 AGGGGGCTGGGCCCTCTGGCTGG + Intergenic
1132836946 16:1958931-1958953 TGGGCACAGGGCCCTCTGGCCGG - Intergenic
1133001124 16:2852291-2852313 AGGCCTCAGGGGCCTCAGGATGG - Intergenic
1133025603 16:2987795-2987817 AGGACAAAGGGCCCCCTGGTGGG + Intergenic
1133143875 16:3769209-3769231 CGGGCTCAGTGTCCTCTGCTTGG + Exonic
1136285221 16:29236665-29236687 TGGGCTCAGGGCCCACTGGCTGG + Intergenic
1138497821 16:57419029-57419051 AGAGCAGAGTGCCCTCTGGTGGG - Intergenic
1141629089 16:85277120-85277142 GGGTCTCAGGGGCCTCTGATGGG - Intergenic
1142090287 16:88206290-88206312 TGGGCTCAGGGCCCACTGGCTGG + Intergenic
1142806118 17:2372139-2372161 GGGGCTGCGGCCCCTCTGGTGGG - Intronic
1145737706 17:27244663-27244685 CTGGCACAGGCCCCTCTGGTTGG + Intergenic
1145941718 17:28746233-28746255 AGGACTCAGGGCCCTGGGGCAGG - Intronic
1147323541 17:39659675-39659697 AGGGAGCTGGGCCCTCGGGTCGG + Intronic
1148587955 17:48794244-48794266 AGGGCCCAGGGCCTGCTGTTGGG + Intronic
1148848119 17:50540963-50540985 AGGGCCCAGGGGTCTGTGGTGGG - Exonic
1149814215 17:59707219-59707241 AGGGCTCAGCGGCCCCTGGGCGG + Intronic
1150294709 17:64001596-64001618 AGGGCCCTGTGCCCTCTGGTGGG + Intronic
1151336580 17:73443578-73443600 AGGGCTCAGGGCTGGCTCGTTGG + Intronic
1151890216 17:76947151-76947173 TGGGCTCAGGGCCCTGGGGCAGG + Intronic
1151935741 17:77259730-77259752 AGGGCTCTTCGGCCTCTGGTGGG + Intergenic
1152190268 17:78883819-78883841 AGGGGGCAGGGCCCTGGGGTTGG - Intronic
1152842496 17:82579481-82579503 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842514 17:82579551-82579573 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842532 17:82579621-82579643 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842568 17:82579760-82579782 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842603 17:82579900-82579922 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842622 17:82579970-82579992 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842640 17:82580040-82580062 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842658 17:82580110-82580132 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842676 17:82580180-82580202 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842713 17:82580320-82580342 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842732 17:82580390-82580412 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842751 17:82580460-82580482 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842770 17:82580530-82580552 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842789 17:82580600-82580622 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842807 17:82580670-82580692 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842826 17:82580740-82580762 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842845 17:82580810-82580832 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152842863 17:82580880-82580902 AGGGATCTGGGCCCTGTGGATGG - Intronic
1152846271 17:82601575-82601597 GGGGTGCAGGGCCCTGTGGTTGG + Exonic
1154485301 18:14867618-14867640 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1159956174 18:74519858-74519880 AGGGCTCAGGGCCCCCAAGCTGG + Intronic
1160381287 18:78458150-78458172 AGCTCTCAGGGCCCTCGGATTGG - Intergenic
1160788276 19:912001-912023 GGGGCCCAGGACCCTCTGGCGGG + Intronic
1160811840 19:1016212-1016234 AGGGGGCAGGGCCCTCTGCTGGG + Intronic
1160843616 19:1157149-1157171 AGGGCTCAGGACCATGGGGTGGG - Intronic
1161405717 19:4090186-4090208 AGGGCGCAGGGCCCTCCCTTAGG - Intergenic
1161616398 19:5273268-5273290 AGGGCCCAGCGCCTACTGGTGGG - Intronic
1163472499 19:17505654-17505676 AGGGTTCAGGGCCCTCCAGCAGG - Exonic
1163530332 19:17844934-17844956 AGCACTCAGGGCCCTCAGCTGGG + Intronic
1165746733 19:38233971-38233993 GGGCCACAGCGCCCTCTGGTGGG - Intergenic
1166959709 19:46490068-46490090 ACCGCTCAGGGCCCTCTGCAGGG + Intronic
1167036755 19:46999412-46999434 AAGTCGCAGGGCCTTCTGGTTGG + Intronic
1168507842 19:56951352-56951374 AGGGTTTGGGGCACTCTGGTTGG - Intergenic
925026507 2:611739-611761 AGGGCTCAGGGGTCTCAGGCAGG + Intergenic
925162437 2:1695292-1695314 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162463 2:1695411-1695433 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162474 2:1695455-1695477 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162505 2:1695587-1695609 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162532 2:1695706-1695728 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162543 2:1695750-1695772 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162554 2:1695794-1695816 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162575 2:1695882-1695904 AGGGCACAGGGGCCTGTGGATGG - Intronic
925162602 2:1696001-1696023 AGGGCACAGGGGCCTGTGGATGG - Intronic
925254123 2:2467831-2467853 AGCCCACAGGCCCCTCTGGTGGG + Intergenic
925549647 2:5058312-5058334 ACAGCTCAGGGACATCTGGTGGG - Intergenic
926009376 2:9396177-9396199 AAGGCTCAGGACCCTCTGGAAGG - Intronic
927210322 2:20635080-20635102 AGGGCTGAAGCCCCTCTGTTGGG - Intronic
927860666 2:26558216-26558238 AGGGCACAGAGCCCTCTGCCTGG - Intronic
928103617 2:28453562-28453584 GGGGCTCAGGTCCCTGTGCTGGG - Intergenic
928111943 2:28517500-28517522 CAGGCTCAGGACACTCTGGTAGG + Intronic
930538240 2:52670965-52670987 AGTTCTGAGGCCCCTCTGGTAGG + Intergenic
931721853 2:65072463-65072485 AGGGCGCCGGGCACTCTGGCTGG - Exonic
932281422 2:70496024-70496046 AGTGCTCAGGAGCCTCTGGTTGG - Intronic
933984130 2:87576290-87576312 AGATCTCAGGGCTCTGTGGTTGG + Intergenic
934574599 2:95392045-95392067 AAGGCTCAGGGCCCTGTGCCTGG - Intergenic
936111752 2:109670794-109670816 AGGGGACAGGGCCCTGTGGGTGG + Intergenic
936309723 2:111374506-111374528 AGATCTCAGGGCTCTGTGGTTGG - Intergenic
936438455 2:112529084-112529106 AGGGCACTGGGACCTCTGGTCGG + Exonic
938187633 2:129245998-129246020 TGTGCACAAGGCCCTCTGGTGGG + Intergenic
939183370 2:138829501-138829523 AGGGCAGGGGGCCCTCTGCTGGG + Intergenic
941180854 2:162257633-162257655 AGTAGTCAGGGCTCTCTGGTAGG - Intergenic
942449917 2:176102301-176102323 AAGGCTCAGGGCTCTCTGTGAGG - Intergenic
943343177 2:186705756-186705778 AGGGTTTAGAGCCTTCTGGTTGG - Intronic
944907883 2:204281092-204281114 AGGGTTTAGGGCTCTATGGTAGG + Intergenic
946032399 2:216715651-216715673 AGGACTCAGGGAACTCTGGCAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948523812 2:238558465-238558487 TGGGCTCAGGGACCTCAGCTGGG - Intergenic
948603435 2:239120287-239120309 AGGCCTCAGGGACCAGTGGTAGG + Intronic
948994464 2:241571425-241571447 AGCGCTCAGACCCCTCTGCTGGG + Intronic
1168810542 20:701756-701778 AGGGCTCAGCTGCCTCTGGAGGG + Intergenic
1171432088 20:25089389-25089411 GGGGCTCAGGGTCCTCTGGGGGG - Intergenic
1173827319 20:46056297-46056319 AGGGCTCTGCTCCCACTGGTTGG - Intronic
1174528774 20:51194334-51194356 AGAGCTCAGGGACCGCTGGGGGG + Intergenic
1175270391 20:57729936-57729958 TGGGCTCAGGGATCTCTGGAAGG - Intergenic
1175296113 20:57909864-57909886 AGGGCTCAGGGCTCTGTCGCTGG + Intergenic
1175431653 20:58909233-58909255 AGGGCTCAGAGTCCTCTGGTGGG - Intronic
1175936487 20:62516616-62516638 AGGGCTCAGGGGTCTCAGGCTGG - Intergenic
1176179487 20:63742646-63742668 GGGTCTCAGGGCTCTCTGGAGGG + Intronic
1176723942 21:10414526-10414548 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1176796033 21:13371858-13371880 GGGGCTCAGGGTCCTGTGGGTGG - Intergenic
1178437133 21:32569792-32569814 AGGGCGCAGCCCCCCCTGGTCGG + Intergenic
1178973821 21:37205125-37205147 GAGGATCAGGGCCCTGTGGTGGG + Intergenic
1179048075 21:37864630-37864652 GGGACTCAGGCCCTTCTGGTAGG + Intronic
1180063776 21:45402788-45402810 GAGGCTCTGTGCCCTCTGGTAGG - Intergenic
1180303455 22:11055075-11055097 ATGCCCCAGGGCCCTCTGCTGGG - Intergenic
1180305188 22:11067700-11067722 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1180960345 22:19759585-19759607 AGGGCTCAGGGTCCTCCGACCGG + Exonic
1181001361 22:19989225-19989247 GGTGCTCAGAGGCCTCTGGTGGG - Intronic
1181091136 22:20473310-20473332 AGGACTCAAGGCCCTCTGCTGGG + Intronic
1181412508 22:22734230-22734252 ATGGCACAGTGCCCTCTGCTTGG - Intergenic
1181620076 22:24085014-24085036 AGGGGTCAGCCCCCTCTGGGAGG - Exonic
1182065017 22:27424764-27424786 AGAGCTCAGGGCCATCTGGTGGG + Intergenic
1182082004 22:27536244-27536266 AGGCCTCAGGGTCCTCTGTGTGG + Intergenic
1183281480 22:36934917-36934939 TGGGATCAGGGGCCTCTGGAGGG + Intronic
1183625148 22:38997281-38997303 AGGGCCTGGGGCCCTCTGGGAGG + Intergenic
1183862617 22:40680742-40680764 ATGGCTCAGGGCACTCTGGTAGG + Intronic
1184092583 22:42300223-42300245 AGGGCTTTGGGGCCTCTGCTAGG + Intronic
1184100690 22:42340496-42340518 AGGGCCCAGGGCCTCCTGGGAGG + Intronic
1184695926 22:46139150-46139172 AGGACTCAGGTCCCACTGGGAGG + Intergenic
1184955001 22:47880027-47880049 AGGGCTGAGTGGCCCCTGGTGGG - Intergenic
1185279836 22:49965345-49965367 TGGACTCAGGGCACGCTGGTTGG - Intergenic
949966234 3:9358860-9358882 AGGGCCAAGGGCCCTCTGATGGG - Intronic
951362643 3:21742675-21742697 AGGGCCCAGGGCCTCCTGGCAGG - Intronic
953417329 3:42730522-42730544 AGAGATCAAGGCCCTCTGGCAGG - Exonic
954426887 3:50448030-50448052 AGGGCTCAAGGCCCTGGGGGAGG - Intronic
954807328 3:53228174-53228196 AAGGCTCAGGGCCCTGGGGCAGG + Intronic
954844464 3:53543429-53543451 AGGATTCAGGGCCCTCTCTTTGG + Intronic
955228253 3:57078692-57078714 CGGGCTCAGGGCGCTCCGGGCGG - Intronic
956873454 3:73440491-73440513 AGGCCTCAGGCCCCTCAGCTTGG - Intronic
957385474 3:79490739-79490761 AGGACTCAAGCCCCTCTGATTGG + Intronic
958175271 3:89989370-89989392 AGGACCCAGGGCCCCCTGCTGGG + Intergenic
962214268 3:133506836-133506858 AGGGCTCAGGGCCAGCAGGGAGG + Intergenic
962820482 3:139044022-139044044 AGAGCACAGGGCCCTCGGATGGG + Exonic
968516065 4:1016144-1016166 AGGGCTCTTGGCCCCCAGGTGGG - Intronic
969070625 4:4535509-4535531 GTGTCTCTGGGCCCTCTGGTTGG + Intronic
969478268 4:7433422-7433444 TGGGCCCAGGGCACACTGGTCGG + Exonic
969675663 4:8613039-8613061 GGGGCTGAGGGCCCTCTGCCTGG - Intronic
970561232 4:17284080-17284102 AGGACTCAGGCCCCTCTAGCTGG + Intergenic
970972899 4:22005583-22005605 AGGGTTCAGGCCCCACTGGCAGG + Intergenic
971166548 4:24189828-24189850 GGAGCTCAGGGCAGTCTGGTGGG - Intergenic
973082502 4:46011769-46011791 AGGACTCAGGCCCCTTTGGCTGG + Intergenic
973605979 4:52588275-52588297 AGGGTCCAGTGCCCTCTAGTGGG - Intergenic
974537392 4:63188917-63188939 AGGGATCAGGGCCCTCAGCAAGG + Intergenic
980290637 4:130844943-130844965 AGGGATCAGGGCCCTCAGCAAGG - Intergenic
983005144 4:162475420-162475442 GGGACTCAGGCCCCTCTGGCTGG + Intergenic
983593671 4:169441944-169441966 GGGTCTCAGGGCCCTCTGGAAGG - Intronic
984145000 4:176049546-176049568 AGAGGTCAGGACACTCTGGTAGG + Intergenic
988258997 5:28858901-28858923 AGGACTCAGGCTCCTCTGGCTGG + Intergenic
990818824 5:59814710-59814732 GGGGCTTAGGGCTCTCTGCTGGG + Intronic
994428771 5:99628453-99628475 AGGGCCCAGGGCTCTTTAGTTGG + Intergenic
995742745 5:115371956-115371978 ATGGATGAGGGCCCTATGGTTGG + Intergenic
997848347 5:137308564-137308586 AGGAGCCAGGGCCTTCTGGTAGG - Intronic
1000085494 5:157884344-157884366 AGGGATCAGGGCCCTCAGCAAGG + Intergenic
1000589921 5:163146177-163146199 CAGGCACTGGGCCCTCTGGTAGG + Intergenic
1001591655 5:172869504-172869526 TGGGCTCAGGTCCCTCAGCTGGG + Intronic
1002132457 5:177089904-177089926 AGGGCGCAGGGCCCTAAGCTGGG + Intronic
1002381225 5:178831453-178831475 GGGGCTCAGGGCCCTGTGGGTGG - Intergenic
1002724084 5:181283057-181283079 GGGGCTCAGGGTCCTGTGGGTGG + Intergenic
1003887092 6:10531666-10531688 AGGGCTCAGGAAAGTCTGGTGGG + Intronic
1005922983 6:30417350-30417372 AGGGTGCAGGGCCATGTGGTGGG - Intergenic
1006105245 6:31712501-31712523 AGGGCCCAGTGCCCTCTGCCAGG - Exonic
1006107804 6:31727263-31727285 CGGGCTCAGCTCCCTCTGCTTGG - Exonic
1006845073 6:37056218-37056240 TGGGCTCAGGGCACTCTAGTGGG + Intergenic
1007783023 6:44265026-44265048 AGGGCTCAGCGCCCCCACGTGGG + Exonic
1009804226 6:68581434-68581456 AATGCTCAGGCCCCTCTGGTGGG - Intergenic
1013371331 6:109473362-109473384 TGGGCACAGGGCCCTCAGGCAGG - Intronic
1016877832 6:148881367-148881389 ATGGCTCAAGTCCCTCTGATGGG - Intronic
1018296569 6:162352226-162352248 GGTTCTCAGGGCCCCCTGGTGGG - Intronic
1018982027 6:168608371-168608393 TGGACTCAGGGCCCTCTGCAAGG - Intronic
1019286934 7:228391-228413 AGGACTCAGGCCCCTCTGCTGGG + Exonic
1019447651 7:1079733-1079755 AGGGCCCTGGACCCTCTGGAGGG - Intronic
1019493731 7:1326639-1326661 AGGCTCCAGGGCCCTGTGGTTGG - Intergenic
1019620265 7:1988363-1988385 GGGCCTCAGGTCCCTGTGGTGGG - Intronic
1023621936 7:42082300-42082322 AGGGCTCAGTGCACTGTGGGAGG + Intronic
1024241233 7:47438318-47438340 AGGGCTCCAGGCCCTCTGCATGG + Intronic
1026095564 7:67343702-67343724 AGGGCTCAGTGCCAGCTGGCTGG + Intergenic
1026208434 7:68279974-68279996 AGGACTCAGGAGCCTGTGGTAGG - Intergenic
1032263565 7:130355079-130355101 AGGACCCAGGCCCCTCTGTTGGG + Intronic
1032332952 7:130997029-130997051 AAGGCTCAGGGCCATCTGTACGG + Intergenic
1032570719 7:132993570-132993592 AGAGCTCAGGTCCCACTGTTGGG + Intronic
1032883850 7:136116755-136116777 AGGACTCAGGGCTCCATGGTGGG + Intergenic
1033447615 7:141436511-141436533 AGGGCCCAGGGAGCTGTGGTGGG + Intronic
1034415417 7:150962011-150962033 AGAGCTCAGGGCCCTCGGGCGGG - Intronic
1036659853 8:10700917-10700939 ATGGCTCTGGGTCCTCTTGTGGG - Intronic
1036681122 8:10875106-10875128 AGGGCTCAGAGGCATCTGTTGGG + Intergenic
1037743132 8:21622927-21622949 AGGGCCCAGTGCCACCTGGTTGG + Intergenic
1037779107 8:21855661-21855683 GAAGCTCAGGGCCCTCTGGAAGG - Intergenic
1038415191 8:27389830-27389852 AGGGCTGAGAGGGCTCTGGTTGG + Intronic
1039093452 8:33857478-33857500 AGCCCTCAGGCCCCTCTGGCAGG + Intergenic
1040481513 8:47831629-47831651 AGCCCTCATGGCGCTCTGGTGGG - Intronic
1048339766 8:133529551-133529573 GGGGCTCCGGGCCCCATGGTGGG + Intronic
1048984440 8:139727260-139727282 AAAGCTCAGGGCCCACTGGCTGG - Intergenic
1053013812 9:34650455-34650477 AGGATTCAAGGCCCTGTGGTCGG - Exonic
1056712234 9:89000490-89000512 AGGCCTCAGGGCTCTCTGCCAGG + Exonic
1057036204 9:91813469-91813491 AGCACTCAGGGCCCACTGGGTGG + Intronic
1057304595 9:93904853-93904875 GGGGCTCAGGGTCCTCTGTGGGG - Intergenic
1057669655 9:97076875-97076897 AGGGCTGAGGGCCCGCAGCTGGG + Intergenic
1060737218 9:126073679-126073701 TGGGCTCAGATCCCTCTTGTGGG + Intergenic
1060743742 9:126116501-126116523 AGGGCCCAAGCCCCTCAGGTGGG - Intergenic
1060971320 9:127739793-127739815 AGGGCTCAGGGCCCTCTGGTGGG + Exonic
1061098047 9:128471509-128471531 AGGGCTCAAGGCAGCCTGGTAGG - Intronic
1061613249 9:131762576-131762598 AGGGCGCGCGGCCCTCTGGCGGG + Intergenic
1061730488 9:132610199-132610221 AGGCATCATGGCCCTCTGGGAGG + Intronic
1061856641 9:133445219-133445241 AGGGCTCAGGGCCCCTGGGAAGG + Intronic
1061884143 9:133583196-133583218 ATGGCTGAGGGCCCACTGCTAGG + Intronic
1061971702 9:134048730-134048752 AGGGCTCAGGGGTCCCGGGTGGG + Intronic
1062071334 9:134556561-134556583 GGGGCACAGAGCCCACTGGTAGG - Intergenic
1062187554 9:135226849-135226871 AGGACACAGGGGGCTCTGGTGGG - Intergenic
1062365660 9:136207814-136207836 AGAGCACAGGCCCCTCTGTTGGG - Exonic
1062447293 9:136600295-136600317 AGAGCACAGGGGCCTCTGGCTGG + Intergenic
1186463229 X:9765188-9765210 AGGGCGCATGGCCCGCAGGTTGG - Intronic
1189193712 X:39134214-39134236 TGGGCTCTGGGCCCTGTGGTTGG + Intergenic
1189548712 X:42071320-42071342 AAGGCTCAGGGTCCTGTGGCAGG + Intergenic
1190627145 X:52346821-52346843 AGTGCTCAGGGCAGTCAGGTGGG + Intergenic
1196688617 X:118534787-118534809 AGTTCTCAGGGCTCTCTGCTAGG + Intronic
1196782995 X:119399592-119399614 GGGGCTCCGGGCCCTGTGGAAGG + Exonic
1196862765 X:120043172-120043194 AGGGGTCAGGGCACTGGGGTGGG - Intergenic
1196880337 X:120193172-120193194 AGGGGTCAGGGCACTGGGGTGGG + Intergenic
1200179788 X:154143396-154143418 AGGGGACAGGGCCCGTTGGTTGG + Intergenic
1202181130 Y:22140879-22140901 AGGTTTCAGGGCCCTCTGACAGG - Intergenic
1202210230 Y:22445521-22445543 AGGTTTCAGGGCCCTCTGACAGG + Intergenic