ID: 1060973922

View in Genome Browser
Species Human (GRCh38)
Location 9:127754167-127754189
Sequence GGAGGCGGTGAGATCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 876}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060973922_1060973932 9 Left 1060973922 9:127754167-127754189 CCAGAGATGATCTCACCGCCTCC 0: 1
1: 0
2: 1
3: 27
4: 876
Right 1060973932 9:127754199-127754221 CGCGCCTGATTGGCCGGTGCGGG No data
1060973922_1060973936 30 Left 1060973922 9:127754167-127754189 CCAGAGATGATCTCACCGCCTCC 0: 1
1: 0
2: 1
3: 27
4: 876
Right 1060973936 9:127754220-127754242 GGGATGCTGCGCTCCGCCGCCGG No data
1060973922_1060973933 10 Left 1060973922 9:127754167-127754189 CCAGAGATGATCTCACCGCCTCC 0: 1
1: 0
2: 1
3: 27
4: 876
Right 1060973933 9:127754200-127754222 GCGCCTGATTGGCCGGTGCGGGG No data
1060973922_1060973930 3 Left 1060973922 9:127754167-127754189 CCAGAGATGATCTCACCGCCTCC 0: 1
1: 0
2: 1
3: 27
4: 876
Right 1060973930 9:127754193-127754215 CCTGCGCGCGCCTGATTGGCCGG No data
1060973922_1060973931 8 Left 1060973922 9:127754167-127754189 CCAGAGATGATCTCACCGCCTCC 0: 1
1: 0
2: 1
3: 27
4: 876
Right 1060973931 9:127754198-127754220 GCGCGCCTGATTGGCCGGTGCGG No data
1060973922_1060973928 -1 Left 1060973922 9:127754167-127754189 CCAGAGATGATCTCACCGCCTCC 0: 1
1: 0
2: 1
3: 27
4: 876
Right 1060973928 9:127754189-127754211 CCGGCCTGCGCGCGCCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060973922 Original CRISPR GGAGGCGGTGAGATCATCTC TGG (reversed) Intronic
900250497 1:1666222-1666244 GGTGGTGGTGAGATCAGCCCAGG + Intronic
900267779 1:1767938-1767960 TGAGGCGGGCAGATCATCTGAGG + Intronic
900655166 1:3753233-3753255 GGAGCCGGGGTGACCATCTCGGG - Intronic
901044928 1:6390337-6390359 CGAGGCGGGCAGATCATCTAAGG + Intronic
901097387 1:6693143-6693165 GGAGGCGGGCAGATCACCTGAGG - Intronic
901222608 1:7592129-7592151 TGAGGCGGGCAGATCATCTGAGG - Intronic
901409991 1:9076186-9076208 CGAGGCGGTCAGATCATTTGAGG - Intronic
901718471 1:11175978-11176000 TGAGGCGGTTAGATCATTTGAGG - Intronic
902906273 1:19560210-19560232 CGAGGCGGGCAGATCATCTGAGG + Intergenic
903306379 1:22415988-22416010 AGAGGCGGGCAGATCATCTGGGG + Intergenic
903729354 1:25479639-25479661 TGAGGCGGGCAGATCATCTGAGG - Intronic
903814500 1:26054732-26054754 TGAGGCGGTCAGATCACCTGAGG + Intronic
903913444 1:26745817-26745839 TGAGGCGGTGAGATCACCTGAGG + Intronic
904163729 1:28539527-28539549 CGAGGCGGGCAGATCATCTGCGG - Intergenic
904179654 1:28657232-28657254 TGAGGCGGGCAGATCATCTGAGG - Intergenic
904197661 1:28797833-28797855 CGAGGCGGTCAGATCACCTGAGG + Intergenic
904561919 1:31404527-31404549 TGAGGCGGGCAGATCACCTCAGG + Intergenic
904579824 1:31534494-31534516 CGAGGCGGGCAGATCATCTGAGG + Intergenic
904636332 1:31884443-31884465 CGAGGCGGGCAGATCATCTGAGG - Intergenic
904713890 1:32452293-32452315 TGAGGCGGACAGATCATCTGAGG - Intergenic
904734277 1:32618541-32618563 TGAGGCGGGCAGATCATCTGAGG - Intronic
904793889 1:33044390-33044412 CGAGGCGGTCAGATCACCTGAGG + Intronic
904845714 1:33413197-33413219 CGAGGCGGGGGGATCATCTGAGG - Intronic
905057499 1:35108583-35108605 CGAGGCGGGCAGATCATCTGAGG - Intronic
905106889 1:35568854-35568876 GGAGGGACTGAGATCATCTGGGG + Intergenic
905999129 1:42408651-42408673 TGAGGCGGGCAGATCACCTCAGG - Intronic
906062194 1:42956327-42956349 CGAGGCGGGCAGATCATCTGAGG + Intronic
906234045 1:44192736-44192758 CGAGGCGGTCAGATCACCTGAGG + Intergenic
906286485 1:44591183-44591205 GGAGGTGGACAGATCATCTGAGG - Intronic
906347249 1:45024885-45024907 TGAGGCGGGCAGATCATCTGAGG - Intronic
906400937 1:45504180-45504202 GGAGGCGGGTGGATCATCTGAGG + Intronic
906466277 1:46082830-46082852 GGAGGCGGACAGATCAGCTGAGG + Intronic
906501739 1:46346315-46346337 CGAGGCGGGCAGATCATCTGAGG + Intronic
906610162 1:47196135-47196157 GGAGGCGGGCAGATCATCTGAGG + Intergenic
906619665 1:47265546-47265568 TGAGGCGGGCAGATCATCTGAGG + Intronic
907052282 1:51337657-51337679 TGAGGCGGGCAGATCATCTGAGG - Intronic
907080951 1:51621267-51621289 CGAGGCGGGGAGATCACCTGAGG + Intronic
907519398 1:55013393-55013415 TGAGGCGGGTAGATCATCTGAGG - Intergenic
908263412 1:62356050-62356072 CGAGGCAGGGAGATCATCTGAGG + Intergenic
908854376 1:68407904-68407926 TGAGGCGGGCAGATCATCTGAGG + Intergenic
908947407 1:69516337-69516359 TGAGGCAGTCAGATCATCTGAGG - Intergenic
909411360 1:75355977-75355999 GGAGGTGGGCAGATCATCTGAGG + Intronic
909633137 1:77787619-77787641 GGAGGCGGGCAGATCACCTGAGG - Intronic
909652663 1:77992954-77992976 TGAGGCGGACAGATCACCTCAGG - Intronic
910172786 1:84396350-84396372 TGAGGCGGGTAGATCATCTGAGG + Intergenic
910442604 1:87267853-87267875 GATGGAGGTGAGAGCATCTCAGG - Intergenic
910593589 1:88954128-88954150 CGAGGCGGGTAGATCACCTCAGG - Intronic
912331273 1:108822220-108822242 GGAGGTTGTGAGCTCATCTGTGG - Intronic
912788168 1:112624374-112624396 CAAGGCGGTCAGATCATCTGAGG + Intronic
914447797 1:147764590-147764612 CGAGGCGGGCAGATCATCTGAGG + Intronic
914560830 1:148818047-148818069 GGAGGCGGGCAGATCACCTGAGG - Intronic
914682265 1:149946818-149946840 TGAGGCGGGCAGATCATCTGAGG + Intronic
914694073 1:150059600-150059622 TGAGGCGGGCAGATCATCTGAGG - Intergenic
914844523 1:151274564-151274586 CGAGGCGGGCAGATCATCTGAGG + Intergenic
915192276 1:154161673-154161695 GGAGGCGGGCAGATCACCTGAGG - Intronic
915222225 1:154384318-154384340 CGAGGCGGGCAGATCATCTGAGG - Intergenic
915232548 1:154456437-154456459 GGAGGCGGGCGGATCATCTGAGG - Intronic
915421137 1:155782889-155782911 GGAGGCAGGGGGATCACCTCAGG - Intronic
916311334 1:163401951-163401973 GGAGGCGGGCAGATCATCTGAGG - Intergenic
917608960 1:176667011-176667033 CGAGGCGGGCAGATCATCTGAGG + Intronic
917855010 1:179092612-179092634 GGAGGCGGGCAGATCAGCTGAGG + Intronic
918473595 1:184900046-184900068 CGAGGCGGGCAGATCATCTGAGG - Intronic
918792701 1:188850224-188850246 CGAGGCGGGCAGATCATCTGAGG - Intergenic
919346014 1:196379336-196379358 GGAGGCGGGCACATCATCTGAGG + Intronic
919515174 1:198513390-198513412 CGAGGCGGGCAGATCATCTGAGG - Intergenic
919890825 1:201972996-201973018 GGAGGCGGGCAGATCACCTGAGG - Intergenic
920142213 1:203824845-203824867 TGAGGCAGGCAGATCATCTCAGG + Intronic
920322834 1:205137776-205137798 CGAGGCGGGCAGATCATCTGAGG - Intergenic
921127078 1:212187569-212187591 TGAGGCGGGTAGATCATCTGAGG - Intergenic
921947641 1:220896973-220896995 GGAGGCGGGTGGATCATCTGAGG + Intergenic
922236764 1:223727910-223727932 GGAGACAGTGGGAACATCTCAGG + Intronic
922510400 1:226161388-226161410 GGAGGCGGGCAGATCACCTGAGG - Intronic
922512647 1:226182382-226182404 CGAGGCGGGGAGATCATTTGGGG + Intronic
923709960 1:236379544-236379566 CGAGGCGGGCAGATCACCTCAGG + Intronic
923829592 1:237540472-237540494 CGAGGCGGTCAGATCACCTGAGG + Intronic
923974482 1:239246125-239246147 CGAGGCGGGCAGATCATCTGAGG + Intergenic
923989873 1:239424405-239424427 GGAGGGTGTGAGGTCACCTCAGG + Intronic
924104993 1:240640685-240640707 CGAGGCGGGCAGATCATCTGAGG + Intergenic
924423276 1:243929198-243929220 GGAGGCGGGCAGATCACCTGAGG - Intergenic
924784382 1:247182078-247182100 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1063628942 10:7716501-7716523 GGAGGCGGGTGGATCATCTGAGG + Intronic
1063722517 10:8598588-8598610 TGAGGCGGGTAGATCATCTGAGG + Intergenic
1064007536 10:11710397-11710419 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1064114358 10:12565484-12565506 CGAGGCGGGCAGATCATCTGAGG - Intronic
1064335343 10:14435549-14435571 GGAGGCGGGGAGATTACCTGAGG + Intronic
1064502052 10:15984376-15984398 CGAGGCGGGGAGATCACCTGAGG + Intergenic
1064673468 10:17738743-17738765 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1064800925 10:19071081-19071103 TGAGGCGGGGAGATCACCTGAGG - Intronic
1065359882 10:24879578-24879600 CGAGGCGGGCAGATCATCTGAGG - Intronic
1065487510 10:26249292-26249314 CGAGGCGGACGGATCATCTCAGG - Intronic
1066228781 10:33411635-33411657 GGAGGCAGGCAGATCATCTGAGG + Intergenic
1066375603 10:34855463-34855485 CGAGGCGGACAGATCATCTGAGG - Intergenic
1066439458 10:35424456-35424478 CGAGGCGGTCAGATCACCTGAGG - Intronic
1067095042 10:43294611-43294633 GGAGGGGGTGAGAGGATCCCAGG - Intergenic
1067095051 10:43294632-43294654 GGAGGGGGTGAGATGACCCCAGG - Intergenic
1067420052 10:46137409-46137431 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1067425967 10:46212117-46212139 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1067505399 10:46843894-46843916 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1067571655 10:47376236-47376258 TGAGGAGGTGATATTATCTCTGG + Intronic
1068582601 10:58759190-58759212 TGAGGTGGTCAGATCATCTGAGG - Intronic
1069469663 10:68676645-68676667 GGAGGAGGGCAGATCATCTGAGG - Intronic
1069676115 10:70249164-70249186 CGAGGCGGGCAGATCATCTGAGG + Exonic
1070255661 10:74811422-74811444 CGAGGCGGGCAGATCACCTCAGG + Intergenic
1070571319 10:77640948-77640970 TGAGGCGGTGGGATCACCTGAGG + Intergenic
1070780515 10:79135048-79135070 GGAGGCGGGCAGATCACCTGAGG - Intronic
1072135331 10:92540007-92540029 TGAGGCGGGCAGATCATCTGAGG + Intronic
1072408734 10:95180758-95180780 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1072697944 10:97617940-97617962 GGAGGCGGGCAGATCACCTGAGG + Intronic
1072993153 10:100217642-100217664 GGAGGCGGGCAGATCACCTGAGG + Intronic
1073264333 10:102215917-102215939 GGAGGTGGGCAGATCATCTGAGG - Intergenic
1073311460 10:102545739-102545761 AGAGGCGGGCAGATCATCTGAGG + Intronic
1073691742 10:105817179-105817201 TGAGGCGGGGAGATCACCTGAGG + Intergenic
1073932183 10:108588589-108588611 TGAGGCTGTGAGATCTGCTCAGG - Intergenic
1074293981 10:112165455-112165477 GGAGGCGGGCAGATCACCTGAGG + Intronic
1075252277 10:120890444-120890466 TGAGGCGGGCAGATCACCTCAGG - Intronic
1075363195 10:121858861-121858883 CGAGGCGGGCAGATCATCTGAGG + Intronic
1075424981 10:122334752-122334774 TGAGGCGGGCAGATCATCTGAGG - Intronic
1075514136 10:123095850-123095872 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1075545438 10:123351415-123351437 GGAGGCTGTGGGGTCCTCTCGGG + Intergenic
1075603981 10:123791179-123791201 TGAGGCGGGCAGATCATCTGAGG + Intronic
1075758792 10:124839455-124839477 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1076649344 10:131977038-131977060 CGAGGCGGGCAGATCATCTGAGG + Intronic
1077651488 11:3977025-3977047 GGAGGCGGGCAGATCACCTGAGG - Intronic
1077995951 11:7453012-7453034 CGAGGCAGGGGGATCATCTCAGG - Intronic
1078602878 11:12748999-12749021 GGAGGCGGTGGGATTCTCCCAGG + Intronic
1079476057 11:20830568-20830590 TGAGGCAGGCAGATCATCTCAGG - Intronic
1079629643 11:22658259-22658281 TGAGGCGGGCAGATCATCTGAGG - Intronic
1081300370 11:41443853-41443875 TGAGGCGGTGTGATCACCTGAGG - Intronic
1081561242 11:44219031-44219053 CGAGGCGGGCAGATCATCTGAGG - Intronic
1082202223 11:49386051-49386073 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1082846564 11:57730502-57730524 CGAGGCGGGCAGATCATCTGAGG + Intronic
1082929968 11:58592317-58592339 TGAGGCAGGGAGATCATCTGAGG - Intronic
1083148421 11:60775081-60775103 CGAGGCGGGCAGATCATCTGAGG + Intronic
1083384636 11:62298524-62298546 CGAGGCGGGCAGATCATCTGAGG + Intronic
1083447685 11:62720311-62720333 CGAGGTGGGCAGATCATCTCAGG + Intronic
1083789298 11:64973995-64974017 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1083867610 11:65465692-65465714 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1086186378 11:84021977-84021999 CGAGGCGGGCAGATCATCTGAGG - Intronic
1086462004 11:87015354-87015376 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1086653445 11:89320095-89320117 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1086942929 11:92816741-92816763 GGAGGCGGGCAGATCACTTCAGG + Intronic
1088787259 11:113193411-113193433 CGAGGCGGTTGGATCATCTGAGG + Intronic
1089237107 11:117038815-117038837 GGAGGCGGGCATATCATCTGAGG + Intronic
1089382812 11:118048275-118048297 TGAGGCGGTCAGATCACCTGAGG + Intergenic
1089715086 11:120351701-120351723 CGAGGCGGGCAGATCATCTGAGG - Intronic
1089721742 11:120431055-120431077 CGAGGCGGGCAGATCATCTGAGG + Intronic
1090348461 11:126090383-126090405 GGAGGCGGGTGGATCATCTGAGG - Intergenic
1090374780 11:126281013-126281035 GGAGGTGGGCAGATCACCTCAGG + Intergenic
1090643946 11:128752206-128752228 TGAGGCGGGAAGATCATCTGAGG - Intronic
1091125819 11:133095375-133095397 GGAAGGAGTGAGATAATCTCAGG + Intronic
1091459860 12:635840-635862 CGAGGCGGGCAGATCATCTGAGG + Intronic
1091514841 12:1168717-1168739 CGAGGCGGGCAGATCATCTGAGG - Intronic
1091657717 12:2357736-2357758 TGAGGCGGGTGGATCATCTCAGG + Intronic
1091894270 12:4088373-4088395 TGAGGCGGTCAGATCACCTGAGG - Intergenic
1091939002 12:4458661-4458683 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1092338496 12:7655276-7655298 TGAGGCGGGCAGATCATCTGAGG + Intronic
1092340596 12:7672642-7672664 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1092699985 12:11217635-11217657 GGTGGAGGGGAGATTATCTCGGG + Intergenic
1092878544 12:12869817-12869839 GGAGGCGGGCAGATCACCTGTGG - Intergenic
1093928143 12:24928991-24929013 CGAGGCGGGCAGATCATCTGAGG - Intronic
1094626362 12:32128134-32128156 GGAGGCGGGCAGATCACCTGAGG - Intronic
1094639487 12:32260155-32260177 GGAGGCGGGTGGATCATCTGAGG - Intronic
1094684743 12:32700350-32700372 TGAGGCGGGCAGATCATCTGAGG - Intronic
1095447164 12:42293926-42293948 AGAGGCGGGCAGATCATCTGAGG - Intronic
1096485662 12:51979231-51979253 CGAGGCGGGTAGATCACCTCAGG + Intronic
1096621947 12:52870683-52870705 GGAGGCGGAGAGGTGAGCTCGGG + Intergenic
1096689864 12:53313839-53313861 GGAGGCGGTTGGATCACCTGAGG - Intronic
1096699963 12:53376012-53376034 TGAGGCGGGCAGATCAACTCAGG + Intergenic
1097005353 12:55912730-55912752 GGAGGCGGGTGGATCATCTGAGG + Intronic
1097135443 12:56849702-56849724 GGAGGCGGGCAGGTCATCTGAGG - Intergenic
1097194062 12:57234169-57234191 GAAGGCAGTGAGATCAGCTGGGG - Intronic
1097682843 12:62665279-62665301 GGAGGCGGGCAGATCACCTGAGG - Intronic
1098199668 12:68041358-68041380 GGAGATGGTGAGATCAGATCAGG - Intergenic
1098293563 12:68981662-68981684 GGAGAGGGTGAGATCAGCTCTGG + Intergenic
1098365045 12:69693495-69693517 GGAGGCGGGCGGATCATCTGAGG - Intronic
1098561182 12:71874853-71874875 AGAGGCGGGCAGATCACCTCAGG - Intronic
1098579485 12:72082084-72082106 AGAGGCGATGAGAGCATCTGAGG - Intronic
1099065601 12:77974528-77974550 TGAGGCGGGCAGATCATCTGAGG - Intronic
1099192190 12:79572066-79572088 CGAGGCGGTCAGATCACCTGAGG + Intergenic
1101159384 12:101958108-101958130 GGAGGCTGGGAGTTCATCTTGGG + Intronic
1101900894 12:108790380-108790402 TGAGGCGGGCAGATCATCTGAGG - Intronic
1102122847 12:110456095-110456117 TGAGGCGGGCAGATCACCTCAGG + Intronic
1102229833 12:111255067-111255089 CGAGGCGGAGGGATCATCTGTGG - Intronic
1102320122 12:111926023-111926045 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1102719935 12:115007414-115007436 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1102912982 12:116732473-116732495 CGAGGCGGGCAGATCATCTGAGG + Intronic
1103073519 12:117964043-117964065 CGAGGCGGGCAGATCATCTGAGG + Intronic
1103306994 12:119973123-119973145 TGAGGCGGTCGGATCATCTGAGG - Intergenic
1103378990 12:120479227-120479249 TGAGGCGGGCAGATCATCTGAGG + Intronic
1103536243 12:121635490-121635512 TGAGGTGGGGAGATCATCTGAGG + Intronic
1103544953 12:121693717-121693739 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1103582988 12:121929908-121929930 CGAGGCGGGTGGATCATCTCAGG - Intronic
1103656716 12:122476788-122476810 GGAGGCGGGCAGATCACCTGAGG + Intronic
1103775070 12:123361314-123361336 GGAGGTGGGTGGATCATCTCAGG + Intronic
1104223496 12:126809195-126809217 TGAGGCGGGTAGATCATCTGAGG - Intergenic
1104531214 12:129572679-129572701 CGAGGCGGGCAGATCATCTGAGG - Intronic
1105010012 12:132749386-132749408 TGAGGCGGGTGGATCATCTCAGG - Intronic
1106017514 13:25883755-25883777 GGAGGTGGTGAGGTTTTCTCTGG - Intronic
1106085177 13:26535324-26535346 TGAGGTGGGGAGATCATCTGAGG + Intergenic
1106631609 13:31479898-31479920 TGAGGCGGGCAGATCACCTCAGG + Intergenic
1106712801 13:32356300-32356322 TGAGGCGGGCAGATCATCTGAGG - Intronic
1107293620 13:38886628-38886650 GGAGGCGGGAGGATCATCTGAGG - Exonic
1107528828 13:41262102-41262124 CGAGGCGGGCAGATCATCTGAGG + Intronic
1107540966 13:41388740-41388762 GAACGCTGTGAGAACATCTCCGG + Intergenic
1107705360 13:43097703-43097725 TGAGGCGGGGAGATCACCTGAGG + Intronic
1107843875 13:44490663-44490685 CGAGGCGGGCAGATCATCTGAGG + Intronic
1108212177 13:48150113-48150135 GGTGGCAGTGAGATCATCTCTGG - Intergenic
1108618134 13:52155938-52155960 GGAGGCGGGTAGATCACCTGAGG - Intronic
1109219020 13:59622388-59622410 TGAGGTGGGCAGATCATCTCAGG + Intergenic
1109901667 13:68780843-68780865 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1110879794 13:80557921-80557943 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1112136692 13:96586526-96586548 TGAGGCGGGCAGATCATCTGAGG - Intronic
1112831310 13:103455693-103455715 TGAGGCGGGCAGATCACCTCAGG - Intergenic
1113107763 13:106789832-106789854 CGAGGCGGGTGGATCATCTCAGG - Intergenic
1113194502 13:107786182-107786204 TGAGGCGGGCAGATCATCTGAGG + Intronic
1113496670 13:110735836-110735858 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1113712506 13:112477599-112477621 CGAGGCGGGCAGATCACCTCAGG + Intergenic
1114232062 14:20792115-20792137 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1114506864 14:23222818-23222840 TGAGGCGGGGGGATCATCTGAGG + Intronic
1114616893 14:24073098-24073120 GGTGGAGGTGAGAGCAGCTCAGG + Exonic
1114662928 14:24360178-24360200 CGAGGTGGTCAGATCATCTGAGG + Intergenic
1114741352 14:25101039-25101061 TGAGGCGGGCAGATCATCTAAGG + Intergenic
1114843445 14:26292511-26292533 CGAGGCAGGGAGATCATCTGAGG - Intergenic
1115004748 14:28468378-28468400 AGAGGTGGTGATATCATCCCTGG + Intergenic
1115005673 14:28481367-28481389 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1115750972 14:36489386-36489408 GGAGGCTGAGTGATGATCTCAGG - Intronic
1115902185 14:38164047-38164069 TGAGGCGGCCAGATCATCTGAGG + Intergenic
1115988761 14:39129643-39129665 GGAGGCGGGCAGATCACCTGAGG - Intronic
1116274809 14:42819025-42819047 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1116307661 14:43278910-43278932 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1116846136 14:49866713-49866735 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1117299537 14:54410944-54410966 GGAGGCGGGCAGATCAACTGAGG + Intronic
1117678488 14:58179411-58179433 GGAGGCGGGTAGATCATTTGAGG - Intronic
1118004548 14:61553773-61553795 CGAGGCGGGCAGATCATCTGAGG - Intronic
1118111666 14:62728146-62728168 TGAGGCGGGCAGATCATCTGAGG + Intronic
1118622458 14:67626019-67626041 TGAGGCGGGCAGATCATTTCAGG + Intronic
1118810842 14:69272126-69272148 TGAGGAGGGGAGATCATCTGAGG + Intronic
1118921074 14:70150551-70150573 GGAGGCATTGAGTTCATGTCCGG - Intronic
1119267641 14:73273210-73273232 TGAGGCGGGCAGATCATCTGAGG - Exonic
1120585316 14:86305438-86305460 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1120592702 14:86394730-86394752 CGAGGCGGGGGGATCATCTGAGG + Intergenic
1120794640 14:88619131-88619153 GGAGGCGGGCAGATCACCTGAGG + Exonic
1121080793 14:91106472-91106494 CGAGGCGGGCAGATCATCTGAGG + Intronic
1121298608 14:92850910-92850932 GGAGGCAGGCAGATCATCTGAGG + Intergenic
1121656756 14:95602681-95602703 TGAGGCGGGTGGATCATCTCAGG + Intergenic
1121660637 14:95632629-95632651 GGAGGCTGGGAGATCCTCGCTGG - Intergenic
1121758912 14:96427011-96427033 GGAGGCGGGCAGATCACCTGAGG + Intronic
1121800072 14:96767823-96767845 CGAGGCGGTCAGATCACCTGTGG - Intergenic
1122483479 14:102062842-102062864 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1122556112 14:102581074-102581096 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1123027530 14:105434053-105434075 GGAGGCGGGCAGATCACTTCAGG - Intronic
1123699017 15:22900968-22900990 CGAGGCGGGCAGATCATCTCAGG + Intronic
1124508210 15:30297438-30297460 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1124735345 15:32241218-32241240 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1124927324 15:34083157-34083179 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1125545992 15:40505659-40505681 GGATGAGGTGAGAGGATCTCTGG + Intergenic
1125569777 15:40707537-40707559 TGAGGCGGGTAGATCATCTGAGG - Intronic
1125669601 15:41461277-41461299 AGAGGCGGGTGGATCATCTCAGG - Intronic
1125917787 15:43504785-43504807 CGAGGCGGAGAGATCACCTGAGG + Intronic
1125918945 15:43513094-43513116 TGAGGCGGGGAGATCACCTGAGG + Intronic
1126109265 15:45166366-45166388 CGAGGCGGGCAGATCACCTCAGG - Intergenic
1126367193 15:47906434-47906456 GAAGGAGGAGAGATCATTTCTGG - Intergenic
1126598342 15:50404095-50404117 TGAGGTGGTCAGATCATCTCAGG - Intergenic
1126651973 15:50932209-50932231 TGAGGCAGGGAGATCATCTGAGG - Intronic
1127911718 15:63421747-63421769 GGAGGAGGGCAGATCATCTGAGG + Intergenic
1128020951 15:64389932-64389954 TGAGGCGGTTGGATCATCTGAGG - Intronic
1128140510 15:65297270-65297292 CGAGGCGGGTAGATCATCTGAGG - Intronic
1128286807 15:66444003-66444025 GGAGGCGGGCAGATCACCTGAGG + Intronic
1128490604 15:68138705-68138727 TGAGGCGGGCAGATCATCTGAGG - Intronic
1129138466 15:73575347-73575369 TGAGGCGGGCAGATCATCTGAGG - Intronic
1129637848 15:77341265-77341287 GGAGGCGGGTGGATCATCTGAGG + Intronic
1129646404 15:77437804-77437826 CGAGGCAGGGAGATCATCTGAGG - Intronic
1129983007 15:79891733-79891755 GGAGGCGGGTAGATCATCTGAGG + Intronic
1130261845 15:82360667-82360689 CGAGGCGGGGAGATCACCTGAGG - Intergenic
1130279390 15:82508344-82508366 CGAGGCGGGGAGATCACCTGAGG + Intergenic
1130881597 15:88060407-88060429 GGGGGCCCTGAGACCATCTCAGG + Intronic
1131134206 15:89920880-89920902 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1131274043 15:90965682-90965704 GGAGGCAGGCAGATCATCTGAGG + Intergenic
1131278141 15:90999549-90999571 GGAGGCGGGCAGATCACCTGAGG - Intronic
1131290749 15:91104862-91104884 CGAGGCGGGCAGATCATCTGAGG - Intronic
1131303107 15:91217107-91217129 TGAGGCGGGCAGATCATCTGAGG - Intronic
1131525574 15:93149939-93149961 CGAGGCGGTCAGATCACCTGAGG - Intergenic
1131532733 15:93207532-93207554 TGAGGCGGAGAGATCACCTGAGG + Intergenic
1131899883 15:97076206-97076228 GTAGGGGGTGAAATCATCCCTGG + Intergenic
1132091256 15:98949601-98949623 TGAGGCGGGGAGATCATCTGAGG - Intronic
1132164346 15:99570950-99570972 GGAGGCGGGCAGATCACCTGAGG + Intronic
1132823162 16:1887571-1887593 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1133026270 16:2990201-2990223 GGAGGCGCAGAGAGCCTCTCAGG + Intergenic
1133101080 16:3480362-3480384 CGAGGCGGGCAGATCATCTGAGG + Intronic
1133127952 16:3658356-3658378 GGAGGCGGGGGGATCACCTGAGG - Exonic
1133161042 16:3911979-3912001 GGAGGTGGGCAGATCACCTCAGG + Intergenic
1133275697 16:4637195-4637217 TGAGGCGGGCAGATCACCTCAGG + Intronic
1133502937 16:6382625-6382647 TGAGGCGGGCAGATCATCTGAGG + Intronic
1133609178 16:7417135-7417157 GGAGGCGGGTGGATCATCTGAGG + Intronic
1134130305 16:11644869-11644891 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1134347736 16:13406834-13406856 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1134394439 16:13850217-13850239 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1134681027 16:16125663-16125685 TGAGGCGGTCAGATCACCTGAGG - Intronic
1134691489 16:16193479-16193501 GGAGGCGGGCAGATCACCTGAGG + Intronic
1134844456 16:17428214-17428236 TGAGGCGGGCAGATCATCTGAGG - Intronic
1134877214 16:17711711-17711733 CGAGGCGGACAGATCATCTGAGG + Intergenic
1135018519 16:18944362-18944384 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1135030967 16:19038425-19038447 GGAGGCGGGCAGATCACCTGAGG - Intronic
1135416055 16:22268721-22268743 GGAGGCGGGTGGATCACCTCAGG + Intronic
1135611666 16:23872943-23872965 CGAGGCGGGCAGATCATCTGAGG + Intronic
1135802197 16:25507802-25507824 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1135827176 16:25739107-25739129 TGAGGCGGGCAGATCATCTGAGG + Intronic
1135852810 16:25980010-25980032 GGAGGTAGTGAGATGATCTGAGG - Intronic
1136468556 16:30462586-30462608 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1136470527 16:30476864-30476886 CGAGGCGGGCAGATCACCTCAGG - Intronic
1136615349 16:31395082-31395104 TGAGGCGGGCAGATCATCTGAGG + Intronic
1136643650 16:31589735-31589757 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1137320268 16:47373511-47373533 TGAGGCGGCCAGATCATCTGAGG - Intronic
1137402433 16:48164497-48164519 GGAGGCGGGTAGATCACCTGAGG + Intergenic
1138205072 16:55118741-55118763 GGAGGCTGGGACATCATCTCAGG - Intergenic
1138374608 16:56554156-56554178 CGAGGCGGGCAGATCACCTCAGG + Intergenic
1138561883 16:57805969-57805991 TGAGGCGGGCAGATCACCTCAGG - Intronic
1139609199 16:68042938-68042960 TGAGGCGGGCAGATCATCTGAGG - Intronic
1139910980 16:70397489-70397511 TGAGGCGGGCAGATCATCTGAGG + Intronic
1140038367 16:71388746-71388768 GGAGGCGGGCAGATCACCTGAGG + Intronic
1140268922 16:73445537-73445559 GGAGGCAGGAAGATCTTCTCAGG - Intergenic
1141274137 16:82569830-82569852 CGAGGCGGGCAGATCATCTAAGG - Intergenic
1141509005 16:84500638-84500660 GGAAGCGGTGAGATCAGATGGGG - Intronic
1142199028 16:88752460-88752482 CGACAGGGTGAGATCATCTCAGG + Intronic
1142250911 16:88991487-88991509 CGAGGCGGACAGATCATCTGAGG + Intergenic
1142710459 17:1720542-1720564 GGAGGCGGGCGGATCATCTGAGG + Intronic
1142761673 17:2045711-2045733 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1143164405 17:4890728-4890750 GGAGGCAGTGAGTACCTCTCGGG - Exonic
1143239282 17:5430230-5430252 TGAGGCGGTCGGATCATCTGAGG + Intronic
1143318345 17:6050259-6050281 CGAGGCGGGCAGATCATCTGAGG - Intronic
1143327212 17:6107266-6107288 TGAGGCGGGCAGATCATCTGAGG + Intronic
1143522406 17:7452288-7452310 TGAGGCGGTCAGATCACCTGAGG - Intronic
1143549523 17:7621362-7621384 TGAGGCGGGCAGATCATCTGAGG + Intronic
1143756372 17:9070822-9070844 GGAGGCGGGCAGATCACCTGAGG - Intronic
1143785432 17:9252070-9252092 CGAGGCGGGCAGATCATCTGAGG + Intronic
1144565717 17:16357554-16357576 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1144627472 17:16851709-16851731 TGAGGAGGTGAGTTCAGCTCAGG - Intergenic
1144634858 17:16898937-16898959 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1144776139 17:17785612-17785634 AGAGGCGGTGAGAACCTCTGTGG - Intronic
1144878969 17:18421010-18421032 TGAGGAGGTGAGTTCAGCTCAGG + Intergenic
1145153267 17:20523384-20523406 TGAGGAGGTGAGTTCAGCTCAGG - Intergenic
1145826518 17:27881004-27881026 CGAGGCGGGCAGATCACCTCAGG + Intronic
1145842344 17:28006331-28006353 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1145856383 17:28162398-28162420 TGAGGCGGGCAGATCATCTGAGG + Intronic
1145919083 17:28596871-28596893 GGAGGCGGGCAGATCACCTGAGG + Intronic
1146060672 17:29604773-29604795 GGAGGCGGGCAGATCACCTGAGG - Intronic
1146275480 17:31513200-31513222 GGAGGCGGTGGGTTCCTCTCCGG - Intronic
1146857944 17:36270652-36270674 CGAGGCGGTCAGATCACCTGAGG + Intronic
1146961590 17:36985132-36985154 GGAGGCGGGTGGATCATCTAAGG - Intronic
1147076738 17:37995188-37995210 CGAGGCGGTCAGATCACCTGAGG + Intronic
1147077065 17:37997871-37997893 CGAGGCGGTCAGATCACCTGAGG - Intronic
1147088264 17:38074734-38074756 CGAGGCGGTCAGATCACCTGAGG + Intergenic
1147108946 17:38245783-38245805 CGAGGCGGTCAGATCACCTGAGG - Intergenic
1147182791 17:38697203-38697225 GGAGCAGGTGAGATCATGACGGG - Intergenic
1147204545 17:38827291-38827313 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1147309409 17:39585937-39585959 CGAGGCGGTCAGATCACCTGAGG - Intergenic
1147729644 17:42590437-42590459 TGAGGCGGGCAGATCATCTGAGG + Intronic
1147790450 17:43011284-43011306 CGAGGCGGGCAGATCATCTGAGG + Intronic
1148253901 17:46111440-46111462 GGAGGCAGGGGGATCATCTGAGG - Intronic
1148589208 17:48802935-48802957 TGAGGCGGGCAGATCACCTCAGG + Intronic
1148698530 17:49575244-49575266 GGAGGGGCTGAGATAATCCCTGG - Intergenic
1148865290 17:50625182-50625204 CGAGGCGGCCAGATCATCTGAGG - Intronic
1148942588 17:51227715-51227737 TGAGGCGGGGAGATCACCTGAGG + Intronic
1149601282 17:57894436-57894458 CGAGGCGGGCAGATCATCTGAGG + Intronic
1149900342 17:60471027-60471049 TGAGGCAGAGAGATCATCTGAGG - Intronic
1150071337 17:62152950-62152972 AGAGGCGGGCAGATCATCTGAGG - Intergenic
1150280133 17:63925360-63925382 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1151598917 17:75094452-75094474 CGAGGCGGTCAGATCACCTGAGG + Intronic
1151611074 17:75175550-75175572 TGAGGTGGTCAGATCATCTGAGG - Intergenic
1151648948 17:75453802-75453824 TGAGGCGGGCAGATCATCTGAGG - Intronic
1151938519 17:77278926-77278948 TGAGGCGGGGGGATCACCTCAGG + Intergenic
1152010265 17:77708801-77708823 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1152119201 17:78407627-78407649 GGAGGAGCTGAGATCAGCCCAGG - Intronic
1152132889 17:78487755-78487777 TGAGGCGGGCAGATCATCTAAGG - Intronic
1152201313 17:78948017-78948039 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1152463081 17:80451420-80451442 GGAGGCTGTGGGAAGATCTCTGG + Intergenic
1152622545 17:81372518-81372540 GGCGTGGGTGAGGTCATCTCAGG - Intergenic
1152764840 17:82130733-82130755 TGAGGCGGGCAGATCATCTGAGG - Intronic
1153147774 18:2053037-2053059 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1153229588 18:2923186-2923208 CGAGGCGGGGAGATCACCTGAGG + Intronic
1153294894 18:3535797-3535819 CGAGGCGGGCAGATCATCTGAGG + Intronic
1153460540 18:5328151-5328173 GGAGGCAGGCAGATCATCTGAGG + Intergenic
1153473144 18:5468678-5468700 AGAGGCGGGCAGATCATCTGAGG + Intronic
1153583913 18:6602069-6602091 TGAGGCGGTCAGATCACCTGAGG - Intergenic
1153640357 18:7151558-7151580 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1153660353 18:7320399-7320421 CGAGGTGGGGAGATCATCTGAGG - Intergenic
1153761420 18:8335787-8335809 TGAGGCGGGCAGATCATTTCAGG + Intronic
1153878969 18:9404111-9404133 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1153916755 18:9752455-9752477 CGAGGCGGGCAGATCATCTGAGG - Intronic
1154991780 18:21604007-21604029 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1157376134 18:47167281-47167303 TGAGGCGGGCAGATCATCTGAGG - Intronic
1158132761 18:54171167-54171189 CGAGGCGGGCAGATCATCTGAGG + Intronic
1158924852 18:62245389-62245411 GGAGGCAGGCAGATCATCTGAGG + Intronic
1158991775 18:62875963-62875985 TGAGGCAGGCAGATCATCTCAGG - Intronic
1159270450 18:66142346-66142368 GGAGGAGGTGAGACCATTACAGG + Intergenic
1159752337 18:72318469-72318491 AGAGGCAGTCAGATCATCTGAGG - Intergenic
1159876154 18:73813292-73813314 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1160342482 18:78101721-78101743 GGAGGAGAAGAGAGCATCTCAGG - Intergenic
1160700192 19:502532-502554 CGAGGCGGGCAGATCACCTCAGG - Intronic
1160748557 19:722933-722955 GGAGCCGGTGGGGTCACCTCTGG + Intronic
1160788688 19:913009-913031 GGAGGCGGGGAGAGGATCTCAGG + Intronic
1160884747 19:1340539-1340561 TGAGGCGGGGAGATCACCTGAGG + Intergenic
1160976221 19:1793972-1793994 GGAGGCGGGCAGATCATTTGAGG - Intronic
1161210707 19:3063813-3063835 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1161211277 19:3067279-3067301 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1161422425 19:4183210-4183232 CGAGGCGGTCAGATCACCTGAGG - Intergenic
1161462639 19:4407713-4407735 GGAGGCGGGCAGATCACCTGAGG + Intronic
1161710030 19:5842527-5842549 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1161783359 19:6308200-6308222 CGAGGCGGGCAGATCATCTGAGG + Intronic
1161858612 19:6780804-6780826 TGAGGCGGGCAGATCATCTGAGG - Intronic
1162000538 19:7742221-7742243 CGAGGCGGGCAGATCATCTGAGG + Exonic
1162112250 19:8405624-8405646 CGAGGCGGGTAGATCATCTGAGG - Intronic
1162126712 19:8503400-8503422 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1162136700 19:8559715-8559737 CGAGGCGGGGAGATCATCTAAGG + Intronic
1162206673 19:9061344-9061366 CGAGGCGGGCAGATCAACTCAGG - Intergenic
1162534951 19:11257554-11257576 CGAGGCGGGCAGATCATCTGAGG + Intronic
1162623624 19:11865010-11865032 GGAGGCGGGCAGATCACCTGAGG - Intronic
1162645133 19:12043533-12043555 GGAGGCAGGGAGATCACCTGAGG - Intronic
1162735423 19:12744550-12744572 GGAGGCGGGCAGATCACCTGAGG - Intronic
1162900396 19:13792084-13792106 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1163528815 19:17837645-17837667 TGAGGCGGGCAGATCATCTGAGG - Intronic
1163706897 19:18819766-18819788 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1163839669 19:19599197-19599219 GGAGGCGGGCAGATCACCTGAGG - Intronic
1163970993 19:20795105-20795127 AGAGGCGGGCAGATCATCTGAGG - Intronic
1164045989 19:21542418-21542440 TGAGGCGGGCAGATCATCTGAGG - Intronic
1164077536 19:21834103-21834125 GGAGGCGGGTGGATCATCTGAGG + Intronic
1164175728 19:22772444-22772466 GGAGGCGGGCAGATCACCTGAGG + Intronic
1164199305 19:23003407-23003429 GGAGGCGGGGGGATCACCTGAGG + Intergenic
1164575048 19:29401019-29401041 GGAGGCCGTGAGAGCCTCTCAGG - Intergenic
1164598413 19:29545378-29545400 CGAGGCGGTTAGATCACCTGAGG + Intronic
1164634547 19:29782595-29782617 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1165048006 19:33121549-33121571 TGAGGCGGGCAGATCACCTCAGG - Intronic
1165151450 19:33763088-33763110 TGAGGCGGGCAGATCATCTGAGG - Intronic
1165524711 19:36344235-36344257 CGAGGCGGGCAGATCATCTGAGG - Intronic
1165725314 19:38108755-38108777 TGAGGCGGAGAGATCACCTGAGG + Intronic
1165749126 19:38249436-38249458 CGAGGCGGTCAGATCACCTGAGG + Intronic
1166025591 19:40081298-40081320 CGAGGCGGGCAGATCATCTGAGG + Intronic
1166027688 19:40103542-40103564 TGAGGCGGGCAGATCATCTAAGG + Intergenic
1166211843 19:41311498-41311520 GGAGGCAGGAAGATCACCTCAGG + Intronic
1166258578 19:41622308-41622330 CGAGGCGGGCAGATCATCTGAGG - Intronic
1166668116 19:44693820-44693842 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1166839333 19:45687079-45687101 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1166951181 19:46428923-46428945 GGAGGCGGTGACGTCACCGCGGG - Intergenic
1167077922 19:47260416-47260438 GGAGTCGGTGAGCTCGTCACTGG + Exonic
1167161691 19:47771871-47771893 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1167192896 19:48004174-48004196 CGAGGCGGGCAGATCATCTGAGG - Intronic
1167595319 19:50424412-50424434 TGAGGCGGTCAGATCAACTGAGG + Intronic
1167617747 19:50545173-50545195 CGAGGCGGGCAGATCATCTGAGG + Intronic
1167631903 19:50630653-50630675 CGAGGCGGGCAGATCATCTGAGG - Intronic
1168054445 19:53854240-53854262 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1168214071 19:54912362-54912384 CGAGGCGGGCAGATCATCTGAGG + Intronic
1168693389 19:58391197-58391219 TGAGGCGGGCAGATCATCTGAGG + Intronic
925592024 2:5519402-5519424 GGAGGTGGTGAGATGTGCTCAGG + Intergenic
925929478 2:8695408-8695430 GGAGGCGGGTAGATCACCTGAGG - Intergenic
926085679 2:10018739-10018761 TGAGGCGGGCAGATCATCTGAGG - Intergenic
926381082 2:12290178-12290200 TGAGGCAGTCAGATCATCTGAGG - Intergenic
926525708 2:13977401-13977423 GGAGGCGGGTGGATCATCTGAGG + Intergenic
927039674 2:19215804-19215826 GGAGGCGGGCAGATCACCTGAGG - Intergenic
927588922 2:24335868-24335890 GGAGGCGGGCAGATCACCTGAGG - Intronic
927685209 2:25165840-25165862 GTTGGCGGTGAGCTGATCTCCGG - Intronic
927791637 2:26014748-26014770 CGAGGCGGGCAGATCATGTCAGG - Intergenic
927801776 2:26107011-26107033 TGAGGCGGGCAGATCATCTGAGG + Intronic
927952428 2:27181384-27181406 TGAGGCGGGCAGATCATCTGAGG - Intergenic
927985001 2:27403652-27403674 GGAGGCGGGCAGATCACCTGAGG + Intronic
928129640 2:28640597-28640619 GGAGGGGCTGGGACCATCTCTGG - Intronic
928129809 2:28641373-28641395 CGAGGCGGTCAGATCACCTGAGG + Intronic
928673595 2:33627836-33627858 TGAGGCGGGCAGATCATCTGAGG - Intergenic
929160041 2:38822625-38822647 GGAGGCGGGCAGATCATTTGAGG - Intronic
929463428 2:42123182-42123204 TGAGGCGGGCAGATCATCTGAGG - Intergenic
929493551 2:42419472-42419494 CGAGGCGGGGAGATCACCTGGGG - Intronic
930143834 2:47981082-47981104 CGAGGCGGTCAGATCACCTGAGG - Intergenic
930765007 2:55076630-55076652 GGAGGCAGGCAGATCATCTGAGG - Intronic
931336256 2:61346903-61346925 CGAGGCGGGCAGATCATCTGAGG + Intronic
931398494 2:61909158-61909180 CGAGGCGGGCAGATCATCTGAGG - Intronic
931428651 2:62193069-62193091 CAAGGTGGTGAGATCATCTGGGG - Intergenic
931732812 2:65167989-65168011 CGAGGCGGGCAGATCATCTGAGG - Intergenic
932508793 2:72264336-72264358 CGAGGCGGGCAGATCACCTCAGG + Intronic
932700751 2:73989635-73989657 GGAGGCGGTGACTACTTCTCTGG + Intronic
932875486 2:75446911-75446933 TGAGGCGGTTGGATCATCTGAGG - Intergenic
933809479 2:86023979-86024001 CGAGGCGGGCAGATCATCTGAGG - Exonic
933818250 2:86086290-86086312 GGAGGCAGGCAGATCATCTGAGG - Intronic
934757786 2:96836471-96836493 TGAGGCGGGCAGATCATCTGAGG - Intronic
934935590 2:98463072-98463094 CGAGGCGGGCAGATCATCTGAGG - Intronic
935009387 2:99118216-99118238 TGAGGCGGGCAGATCATCTGAGG + Intronic
935053966 2:99549350-99549372 GGAGGCGGGTAGATCACCTGAGG + Intronic
935055038 2:99558386-99558408 GGAGGCGGGGAGATCACCTGAGG + Intronic
936377088 2:111950166-111950188 GGAGGCGGTCGGATCATTTAAGG - Intronic
936759551 2:115759776-115759798 GGAGGCGGGCAGATCACCTGAGG + Intronic
937435049 2:121873481-121873503 CGAGGCGGGGAGATCACCTGAGG - Intergenic
937973817 2:127568973-127568995 CGAGGCGGGCAGATCATCTGAGG + Intronic
938010868 2:127828028-127828050 CGAGGTGGGCAGATCATCTCAGG - Intergenic
938027926 2:127966468-127966490 CGAGGCGGGCAGATCATCTGAGG + Intronic
938045378 2:128114348-128114370 TGAGGCGGTCAGATCACCTGAGG - Intronic
938502810 2:131840432-131840454 TGAGGCGGGCAGATCATCTGAGG - Intergenic
938715147 2:134012710-134012732 TGAGGCGGGCAGATCATCTGAGG + Intergenic
938743709 2:134257452-134257474 TGAGGCGGGCAGATCATCTGAGG - Intronic
938852302 2:135273767-135273789 CGAGGCGGGCAGATCATCTGAGG - Intronic
939015433 2:136898402-136898424 GGAGGCGGGCAGATCACCTGAGG - Intronic
939373614 2:141334782-141334804 TGAGGCGGGCAGATCATCTGAGG - Intronic
939928019 2:148198045-148198067 TGAGGCGGGGAGATCACCTGAGG - Intronic
940461536 2:153969163-153969185 GGAGGAAGTGAGATCATATCTGG - Intronic
940914815 2:159242426-159242448 GGAGGCGGGCAGATCACCTGAGG + Intronic
941944903 2:171085155-171085177 GGAGGCGGGCAGATCACCTGAGG + Intronic
942032949 2:171980935-171980957 TGAGGCGGGCAGATCATCTGAGG + Intronic
942432349 2:175925894-175925916 TGAGGCGGGCAGATCATCTGGGG - Exonic
942465100 2:176199339-176199361 CGAGGCGGGCAGATCATCTGAGG + Intergenic
944145599 2:196504061-196504083 CGAGGCGGGCAGATCATCTGAGG + Intronic
944549617 2:200833434-200833456 CGAGGCGGGCAGATCATCTGAGG + Intergenic
944574323 2:201076866-201076888 GGAGGCGGGCAGATCACCTGAGG + Intronic
944717832 2:202392758-202392780 CGAGGCGGGCAGATCATCTGAGG + Intronic
944783774 2:203046940-203046962 CGAGGCGGGCAGATCATCTGAGG + Intronic
944800836 2:203236379-203236401 GGAGGCGGTCAGATCACTTGAGG - Intergenic
945255586 2:207800439-207800461 CGAGGCGGGCAGATCATCTGAGG + Intergenic
945921043 2:215755001-215755023 GGACTCAGTGAGATCTTCTCTGG - Intergenic
945952497 2:216053084-216053106 TGAGGCGGGCAGATCATCTGAGG - Intronic
946340803 2:219066964-219066986 CGAGGCGGGCAGATCATCTGAGG + Intergenic
946910445 2:224455596-224455618 TGAGGCGGGCAGATCATCTGAGG + Intergenic
947621119 2:231591854-231591876 TGAGGCGGGCAGATCATCTGAGG - Intergenic
947829350 2:233127838-233127860 CGAGGCGGGCAGATCACCTCAGG - Intronic
948952108 2:241260236-241260258 TGAGGCGGGCAGATCACCTCAGG - Intronic
948969771 2:241415907-241415929 GGAGGCAGTGACAACATCTTTGG + Intronic
1168972636 20:1941353-1941375 GGAGGCGGAGAGCTGAACTCAGG - Intergenic
1169159323 20:3362994-3363016 CGAGGCGGGCAGATCACCTCAGG + Intronic
1169438312 20:5612564-5612586 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1169470490 20:5881197-5881219 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1170933853 20:20793106-20793128 CGAGGCGGGTGGATCATCTCAGG - Intergenic
1172412401 20:34734878-34734900 CGAGGCGGTCAGATCACCTGAGG - Intronic
1172552229 20:35810160-35810182 GGAGGCGGGCAGATCACCTGAGG - Intronic
1173476210 20:43361594-43361616 TGAGGCGGGCAGATCACCTCAGG - Intergenic
1173974494 20:47177028-47177050 CGAGGCGGGCAGATCATCTGAGG - Intronic
1174042535 20:47710132-47710154 TGAGGCGGGCAGATCACCTCAGG - Intronic
1174093579 20:48069403-48069425 CGAGGCAGGGAGATCATCTGAGG - Intergenic
1174319532 20:49730260-49730282 TGAGGCGGTCAGATCACCTGAGG + Intergenic
1174468740 20:50739212-50739234 GGAGGCGGGCGGATCATCTGAGG + Intronic
1174641609 20:52049475-52049497 GGAGGTGGTGACAGCAACTCTGG + Intergenic
1175114064 20:56669516-56669538 GGAGGCGGAGGGATCACCTGAGG - Intergenic
1175410529 20:58764795-58764817 AGAGGCGGGCAGATCATCTGAGG - Intergenic
1175425397 20:58861935-58861957 TGAGGCGGGCAGATCATCTGAGG - Intronic
1175909243 20:62396793-62396815 GGAGGCACTGAGCTCTTCTCTGG + Intronic
1176142335 20:63550211-63550233 GGAGGAGGTGAGGTCATGTGGGG - Intronic
1176192163 20:63816870-63816892 TGAGGCGGGCAGATCATCTGAGG + Intronic
1178143063 21:29706104-29706126 CGAGGCGGACAGATCATCTGAGG - Intronic
1178300566 21:31449608-31449630 CGAGGCGGGCAGATCATCTGAGG - Intronic
1178415627 21:32402774-32402796 TGAGGCGGGTAGATCACCTCAGG + Intergenic
1178423376 21:32459607-32459629 TGAGGCGGGTAGATCACCTCAGG + Intronic
1178516139 21:33249109-33249131 CGAGGCGGGCAGATCATCTAAGG + Intronic
1178822885 21:35991478-35991500 CGAGGCGGGCAGATCATCTGAGG + Intronic
1178954499 21:37010257-37010279 CGAGGCGGTCGGATCATCTGAGG + Intronic
1178958440 21:37043504-37043526 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1179638735 21:42732680-42732702 GGAGGCGGGCAGATCACCTGAGG + Intronic
1179661315 21:42877374-42877396 TGAGGCGGGCAGATCATCTGAGG - Intronic
1179679558 21:43009213-43009235 TGAGGCGGTTGGATCATCTGAGG + Intronic
1179980380 21:44892385-44892407 CGAGGCGGGTAGATCATCTGAGG + Intronic
1180621278 22:17163986-17164008 GGAGGCGGGCAGATCACCTGAGG + Intronic
1180786993 22:18553016-18553038 GGAGGCGGTGAGAGCAGATCAGG - Intergenic
1181136475 22:20770278-20770300 TGAGGCGGGCAGATCATCTGAGG + Intronic
1181234747 22:21442290-21442312 GGAGGCGGTGAGAGCAGATCAGG + Intronic
1181243903 22:21492541-21492563 GGAGGCGGTGAGAGCAGATCAGG - Intergenic
1181628092 22:24134843-24134865 CGAGGCGGGCAGATCATCTGAGG + Intronic
1181694610 22:24586761-24586783 TGAGGCGGTCAGATCACCTGAGG - Intronic
1182220442 22:28754435-28754457 TGAGGCAGACAGATCATCTCAGG + Intronic
1182294606 22:29305687-29305709 GGAGGCGGGCAGATCACCTTAGG + Intergenic
1182606811 22:31512121-31512143 CGAGGCGGGCAGATCATCTGAGG + Intronic
1183086622 22:35490886-35490908 CGAGGCGGGGGGATCACCTCAGG + Intergenic
1183285113 22:36957462-36957484 GGAGGCAGGCAGATCATCTGAGG - Intergenic
1183380805 22:37489616-37489638 GGAGGCTGTGGGAGCCTCTCAGG - Intergenic
1183857032 22:40641640-40641662 GGAGGCGGGGGGATCACCTGAGG + Intergenic
1183940530 22:41292380-41292402 AGAGGCGGGCAGATCATCTGAGG - Intergenic
1184151055 22:42638798-42638820 TGAGGCGGGGGGATCATCTGAGG + Intronic
1184156851 22:42673401-42673423 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1184403280 22:44286170-44286192 TGAGGCAGTGAGAGCATCCCGGG - Intronic
1184997776 22:48223045-48223067 GGAGGCGGTGAGGTGGACTCAGG + Intergenic
1185364435 22:50430639-50430661 GGAGGCGGGCAGATCACCTGAGG + Intronic
949337664 3:2993530-2993552 CGAGGCGGGCAGATCATCTGAGG - Intronic
949339423 3:3012734-3012756 GGAGGCGGGCAGATCACCTGAGG + Intronic
951232490 3:20195469-20195491 TGAGGCGGAGAGATCACCTGAGG - Intergenic
951559587 3:23952475-23952497 GGAGGCGGGCGGATCATCTGAGG + Intronic
951667343 3:25142097-25142119 TGAGGCGGACAGATCATCTGAGG + Intergenic
951692642 3:25412785-25412807 CGAGGCGGGCAGATCACCTCAGG + Intronic
953332763 3:42067937-42067959 CGAGGCGGGCAGATCATCTGAGG + Intronic
953398716 3:42593178-42593200 TGAGGCGGGCAGATCATCTGAGG + Intronic
954307980 3:49741080-49741102 GGAGGCGGGCAGATCACCTGAGG - Intronic
954766733 3:52924407-52924429 TGAGGCGGGAAGATCATCTGAGG + Intronic
955318994 3:57960885-57960907 TGAGGCGGGCAGATCACCTCAGG + Intergenic
956435548 3:69231518-69231540 GGAGGCGGGCAGATCACCTGAGG - Intronic
956836836 3:73102672-73102694 GGAGGCAGGCAGATCATCTGAGG - Intergenic
957166325 3:76678201-76678223 CGAGGCGGTCAGATCACCTGAGG - Intronic
957866103 3:86025287-86025309 CGAGGCGGGCAGATCACCTCAGG - Intronic
958713636 3:97750585-97750607 TGAGGCGGGCAGATCATCTGAGG - Intronic
959484566 3:106911932-106911954 CGAGGCGGGCAGATCATCTGAGG - Intergenic
960132424 3:114071529-114071551 AGAGGCGGGCAGATCATCTAAGG - Intronic
961681072 3:128600541-128600563 TGAGGTGGTCAGATCATCTGAGG - Intergenic
961772642 3:129261206-129261228 GGAGTAGACGAGATCATCTCAGG + Intronic
962765110 3:138555014-138555036 GGAGGCGGGTAGATCATCTGAGG + Intronic
963162616 3:142167139-142167161 CGAGGCGGGCAGATCATCTGAGG + Intronic
963186549 3:142424326-142424348 CGAGGCGGCCAGATCATCTAAGG - Intronic
963329718 3:143900642-143900664 TGAGGCGGGCAGATCATCTGAGG - Intergenic
964112797 3:153104767-153104789 CGAGGCGGGCAGATCATCTGAGG - Intergenic
964765308 3:160173508-160173530 TGAGGCGGGCAGATCATCTGAGG - Intergenic
964843790 3:161024464-161024486 GGAGGCGGGCAGATCACCTGAGG + Intronic
964851801 3:161103957-161103979 CGAGGCGGGCAGATCACCTCAGG - Intronic
964992880 3:162835847-162835869 TGTGGTGCTGAGATCATCTCTGG - Intergenic
965203195 3:165687272-165687294 GGAGGCGGGCGGATCATCTGAGG + Intergenic
965339126 3:167464244-167464266 TGAGGCGGGCAGATCATCTGAGG - Intronic
965503599 3:169485225-169485247 CGAGGCGGTTAGATCACCTGAGG - Intronic
965589135 3:170346009-170346031 TGAGGCGGGCAGATCATCTGAGG + Intergenic
966421833 3:179741587-179741609 GGAGGCGGGTGGATCATCTGAGG - Intronic
966729196 3:183136417-183136439 CGAGGCGGTCAGATCACCTGAGG + Intronic
966751462 3:183326257-183326279 GGAGGCGGACAGATCACCTGAGG + Intronic
966754088 3:183352288-183352310 TGAGGCGGGCAGATCATCTGAGG + Intronic
967788371 3:193521698-193521720 CGAGGCGGGCAGATCACCTCAGG + Intronic
969045811 4:4335809-4335831 TGAGGCGGGCAGATCATCTGAGG + Intergenic
972475895 4:39449090-39449112 CGAGGCGGGGAGATCACCTGAGG + Exonic
972655188 4:41057216-41057238 TGAGGCGGGCAGATCACCTCAGG + Intronic
973170106 4:47131388-47131410 CGAGGCGGGCAGATCATCTGAGG - Intronic
974000094 4:56504097-56504119 CGAGGCGGGCAGATCACCTCAGG + Intergenic
975038620 4:69714914-69714936 CGAGGCGGTCAGATCACCTGAGG - Intergenic
975134970 4:70865902-70865924 CGAGGCGGTCAGATCACCTATGG + Intergenic
975258001 4:72261438-72261460 CGAGGCGGGCAGATCATCTGAGG + Intergenic
975552393 4:75626969-75626991 GGAGGCGGGCAGATCACCTGAGG + Intronic
975932278 4:79539141-79539163 GGGGGCGGGGAGATCATTTGAGG - Intergenic
976303176 4:83534967-83534989 CGAGGCGGGCAGATCATCTGAGG - Intergenic
976541406 4:86281264-86281286 GGAGGCAGGCAGATCACCTCAGG + Intronic
976774248 4:88689808-88689830 CGAGGCGGGCAGATCAGCTCAGG - Intronic
977380450 4:96266667-96266689 CGAGGCAGTGAGATCACCTGAGG - Intergenic
978704002 4:111683512-111683534 TGAGGCGGGCAGATCATCTGAGG + Intergenic
978951888 4:114570637-114570659 GAAGTCGGGGAGATCATTTCAGG + Intergenic
979180094 4:117714757-117714779 CGAGGCGGGCAGATCATCTGAGG + Intergenic
979847746 4:125537833-125537855 CGAGGCGGGCAGATCATCTGAGG + Intergenic
980253352 4:130346952-130346974 GGAGGCAGTGCCATGATCTCAGG + Intergenic
980496989 4:133598835-133598857 GGAGGAGGGGAGTTCATCTTGGG + Intergenic
981386145 4:144132897-144132919 GCAGGCGGTGAGTGCATTTCTGG - Intronic
981713382 4:147731099-147731121 GGAGGCGGGTAGATCACCTGAGG - Intergenic
982377773 4:154713320-154713342 TGAGGCGGTCAGATCACCTGAGG + Intronic
982640206 4:157949458-157949480 CGAGGCGGGGAGATCACCTGAGG + Intergenic
982726351 4:158910503-158910525 TGAGGCGGGCAGATCATCTGAGG - Intronic
984031476 4:174609792-174609814 AGAGGCGGGCAGATCATCTAAGG - Intergenic
985372364 4:189299569-189299591 GGATGAGATGAGATAATCTCGGG - Intergenic
985377166 4:189353807-189353829 TGAGGCGGGCAGATCATCTGAGG - Intergenic
985630901 5:1013504-1013526 GGAGGCGTCGAGGTCACCTCTGG + Intronic
986142970 5:5048929-5048951 CGAGGCGGGGGGATCACCTCAGG + Intergenic
986237624 5:5926835-5926857 TGAGGCGGGCAGATCACCTCAGG - Intergenic
986281117 5:6323314-6323336 GAAGGTGGTGAGATCCTCTGTGG - Intergenic
987035403 5:14013889-14013911 GGAGGCGGAGGGATCACCTGAGG - Intergenic
987336135 5:16899400-16899422 GGAGGCGGGCAGATCACCTGAGG + Intronic
987379338 5:17270230-17270252 CGAGGCGGGCAGATCATCTGAGG - Intronic
987807423 5:22786950-22786972 TGAGGCGGGCAGATCATCTGAGG - Intronic
987825271 5:23023137-23023159 TGAGGCGGGCAGATCATCTGAGG - Intergenic
988436165 5:31177803-31177825 TGAGGCGGGTAGATCACCTCAGG + Intergenic
988516170 5:31906608-31906630 TGAGGCGGGCAGATCATCTGAGG + Intronic
989059084 5:37392574-37392596 TGAGGCGGACAGATCATGTCAGG - Intronic
989061048 5:37412152-37412174 TGAGGCGGGCAGATCATCTGAGG + Intronic
989378049 5:40786020-40786042 CGAGGCGGGGAGATCACCTGAGG + Intronic
989747231 5:44844437-44844459 GGAGGTGGGCAGATCATCTGAGG + Intergenic
990250112 5:53904958-53904980 TGAGGTGGTCAGATCATCTGAGG - Intronic
990258498 5:53996384-53996406 TGAGGCGGGTAGATCATCTGAGG + Intronic
990429640 5:55722029-55722051 GGAGGCGGGTGGATCATCTAAGG - Intronic
990521534 5:56586110-56586132 GAAGGATGTGAGATGATCTCTGG + Intronic
990702455 5:58488832-58488854 TGAGGCGGGCAGATCATCTGAGG - Intergenic
990787646 5:59440542-59440564 TGAGGCGGGCAGATCATCTGAGG + Intronic
991286622 5:64984063-64984085 TGAGGCGGGCAGATCACCTCAGG - Intronic
991290871 5:65032907-65032929 GGTGGCGGTGAGAGCAGCTCAGG - Intergenic
991384508 5:66070273-66070295 TGAGGCGGGCAGATCATCTGAGG - Intronic
991560565 5:67947301-67947323 GGAGGCGGGCAGATCACCTGAGG + Intergenic
991727041 5:69545967-69545989 CGAGGCAGGGAGATCATCTGAGG - Intronic
991867916 5:71081907-71081929 CGAGGCAGGGAGATCATCTGAGG + Intergenic
991966992 5:72102636-72102658 TGAGGCGGGCAGATCATCTGAGG + Intergenic
992249725 5:74865677-74865699 GAAGGCGGTCAGAGCATCTCTGG + Intronic
992725818 5:79606362-79606384 TGAGGCGGGCAGATCATCTGAGG + Intergenic
992743323 5:79795415-79795437 GGAGGCGTGAAGATCATCTCAGG + Intronic
992850877 5:80806327-80806349 CGAGGCGGGCAGATCATCTGAGG - Intronic
994939053 5:106296401-106296423 TGAGGCGGGCAGATCATCTGAGG - Intergenic
995881182 5:116846251-116846273 AGAGGCGGGCAGATCATCTGAGG + Intergenic
995897410 5:117030854-117030876 GGAGGGGATGAGATCACCTAGGG + Intergenic
996716999 5:126596030-126596052 TGAGGCGGGCAGATCATCTCAGG - Intergenic
996893300 5:128448537-128448559 CGAGGCGGGCAGATCATCTGAGG - Intronic
997137245 5:131339572-131339594 TAAGGCGGGCAGATCATCTCAGG + Intronic
997338746 5:133126225-133126247 CGAGGCGGGCAGATCATCTGAGG - Intergenic
997447569 5:133952561-133952583 TGAGGCGGGCAGATCATCTGAGG + Intergenic
997555685 5:134796618-134796640 TGAGGCGGGCAGATCATCTGAGG + Intronic
997974656 5:138433639-138433661 GGAGGCGGGCAGATCACCTGAGG - Intronic
998020237 5:138763950-138763972 GGAGGCGGGCAGATCACCTGAGG + Intronic
998118497 5:139557513-139557535 CGAGGCGGGCAGATCATCTGAGG + Intronic
998258379 5:140608020-140608042 CGAGGCGGGCAGATCATTTCAGG - Intergenic
998352300 5:141509381-141509403 GGAGGCCCTGAGATCCTCTGTGG - Intronic
998369227 5:141650558-141650580 GGAGTCCTTGAGATCACCTCGGG + Intronic
999146398 5:149398672-149398694 GGAGGTGGGCAGATCATCTGAGG + Intronic
999157924 5:149471853-149471875 GGAGACAGTGAAGTCATCTCAGG + Intergenic
999452914 5:151691796-151691818 GCAGGCCGTGAGCTCATTTCAGG + Intergenic
999560904 5:152801529-152801551 TGAGGCGGGCAGATCATCTGAGG - Intergenic
999658703 5:153835686-153835708 CGAGGCGGGCAGATCATCTGAGG + Intergenic
999788007 5:154909744-154909766 TGAGGCGGGCAGATCATCTGAGG + Intronic
1000219073 5:159194402-159194424 GGAGGCGGGTGGATCACCTCAGG - Intronic
1000423447 5:161062934-161062956 TGAGGCGGGCAGATCACCTCAGG + Intergenic
1000876128 5:166640355-166640377 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1000887762 5:166766939-166766961 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1001579412 5:172788814-172788836 CGAGGCGGAGAGATCACCTGAGG - Intergenic
1001787774 5:174428281-174428303 GGAGGCGGGCAGATCATTTGAGG - Intergenic
1002280103 5:178124823-178124845 GGAGGCGGTGAGTTCAGGGCAGG - Exonic
1002463112 5:179386658-179386680 CGAGGCGGGCAGATCACCTCAGG + Intergenic
1003300702 6:4879790-4879812 CGAGGCGGGCAGATCATCTGAGG - Intronic
1003973022 6:11317198-11317220 CGAGGCGGGCAGATCACCTCAGG + Intronic
1004216243 6:13706767-13706789 CGAGGCGGGCAGATCATCTGAGG + Intronic
1004693387 6:18011850-18011872 GGAGGCGGGTAGATCACCTGAGG + Intergenic
1004698506 6:18056479-18056501 CGAGGCGGATGGATCATCTCAGG + Intergenic
1004719438 6:18254096-18254118 CGAGGCGGTCAGATCACCTGAGG + Intronic
1004836374 6:19536349-19536371 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1005354321 6:24968136-24968158 TGAGGCGGGCAGATCATCTGAGG - Intronic
1005461436 6:26073258-26073280 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1005585220 6:27269837-27269859 AGAGGCGGGCAGATCACCTCAGG + Intergenic
1005607463 6:27489125-27489147 TGAGGCGGGGAGATCATTTGAGG - Intergenic
1005649457 6:27873365-27873387 GGAGGCGTTAAGCGCATCTCAGG - Exonic
1005745106 6:28829634-28829656 CGAGGCGGGCAGATCACCTCAGG - Intergenic
1005745449 6:28832912-28832934 GGAGGCGGTCAGATCATTTAAGG + Intergenic
1005942770 6:30573108-30573130 GGAGGCGGGGAGACCATTTAGGG + Intronic
1006194533 6:32230520-32230542 GGTGGAGGTGGGATCATCTGAGG + Intergenic
1006315009 6:33285906-33285928 CGAGGCGGGCAGATCATCTGAGG + Intronic
1006758589 6:36439377-36439399 GGAGGCGGGTGGATCATCTGAGG + Intronic
1006768707 6:36532664-36532686 TGAGGCGGGCAGATCACCTCAGG + Intronic
1006819092 6:36876490-36876512 CGAGGCGGGCAGATCATCTGAGG + Intronic
1006859427 6:37160273-37160295 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1006865032 6:37202426-37202448 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1007483985 6:42168037-42168059 GGAGGCGGGTGGATCATCTGAGG - Intronic
1007504918 6:42328239-42328261 GGAGGCGGGCAGATCACCTGAGG - Intronic
1007550891 6:42728626-42728648 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1007603820 6:43101961-43101983 CGAGGCGGGCAGATCATCTGAGG + Intronic
1007756549 6:44103337-44103359 CGAGGCGGGTAGATCATCTGAGG - Intergenic
1008113671 6:47521317-47521339 CGAGGCGGGCAGATCACCTCAGG + Intronic
1008965817 6:57311792-57311814 GGAGGCGGGCAGATCATCCGAGG + Intergenic
1009472537 6:64045677-64045699 CGAGGCGGGCAGATCATCTGAGG - Intronic
1010419258 6:75653261-75653283 CGAGGCGGGGGGATCACCTCAGG - Intronic
1010932348 6:81818232-81818254 GGAGGCCGTGAGAATATCTGGGG - Intergenic
1011290112 6:85768201-85768223 AAAGGCGATGAGATTATCTCTGG + Intergenic
1013209953 6:107977830-107977852 CGAGGCGGGGAGATCACCTGAGG - Intergenic
1013527416 6:110987289-110987311 CGAGGCGGACAGATCATGTCAGG - Intronic
1013802459 6:113963314-113963336 TGAGGCGGGCAGATCATCTGAGG - Intronic
1013953508 6:115813936-115813958 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1014442573 6:121490416-121490438 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1015770742 6:136765760-136765782 GGAGGCGGGCAGATCACCTGAGG - Intronic
1016934952 6:149442755-149442777 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1016948407 6:149556152-149556174 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1017381769 6:153839530-153839552 TGAGGCGGGGGGATCATCTGAGG - Intergenic
1017599435 6:156064656-156064678 GGAGGAGGTGATATCCTCACCGG + Intergenic
1017919784 6:158861113-158861135 TGAGGCGGGGAGATCACCTGAGG - Intergenic
1017923284 6:158889262-158889284 TGAGGCGGTCAGATCACCTGAGG + Intronic
1018197967 6:161371395-161371417 GGAGGCGGGCAGATCACCTGAGG - Intronic
1018234220 6:161706788-161706810 CGAGGCGGTTAGATCACCTGAGG - Intronic
1018332832 6:162749750-162749772 CGAGGCGGGCAGATCATCTGAGG - Intronic
1018722130 6:166581121-166581143 CGAGGCGGGCAGATCATCTGAGG - Intronic
1019454989 7:1122375-1122397 GGAGGCGGCCAGGTCATCACAGG + Intronic
1019791249 7:3015378-3015400 GGAGGCGGGCAGATCACCTGAGG - Intronic
1019794188 7:3037786-3037808 CGAGGCGGGCAGATCATCTGAGG - Intronic
1020095678 7:5367658-5367680 CGAGGCGGGCAGATCATCTGAGG - Intronic
1020117751 7:5485673-5485695 CGAGGCGGGCAGATCATCTGAGG + Intronic
1020227899 7:6294606-6294628 CGAGGCGGGCAGATCATTTCAGG + Intergenic
1021636366 7:22698091-22698113 GGAGGCTCTGAGATCTTCCCTGG - Intergenic
1021826559 7:24558588-24558610 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1022193101 7:28036569-28036591 GGAGGAGGTAGGGTCATCTCTGG + Intronic
1023044781 7:36201555-36201577 GGAGGCGGGCAGTTCATCCCCGG - Intronic
1023057481 7:36301676-36301698 GGAGGCGGGCAGATCATTTGAGG + Intergenic
1023801506 7:43838983-43839005 GGAGGCGGTGGGGGCTTCTCAGG + Intergenic
1023813547 7:43930901-43930923 TGAGGCGGGCAGATCATCTGAGG + Intronic
1023998602 7:45176992-45177014 GGAGGTGGTGAGAGGGTCTCAGG - Intronic
1024060872 7:45697620-45697642 TGAGGCGGGCAGATCATCTAAGG - Intronic
1024439010 7:49393482-49393504 TGAGGTGGTGAGATAATCTTGGG + Intergenic
1024533377 7:50410830-50410852 GGAGGCTGGGGGATCATCTGGGG - Intergenic
1025098099 7:56113042-56113064 TGAGGCGGGTAGATCATCTGAGG + Intergenic
1025733103 7:64123802-64123824 TGAGGCGGGCAGATCATCTGAGG + Intronic
1025938338 7:66054943-66054965 CGAGGCGGTGGGATCACCTGAGG + Intergenic
1025946180 7:66106632-66106654 CGAGGCGGTGGGATCACCTGAGG - Intronic
1025958766 7:66202839-66202861 GGAGCCGGGCAGATCATCTGAGG + Intergenic
1026643720 7:72149879-72149901 GGAGGCGGGCAGATCACCTGAGG + Intronic
1026779772 7:73257721-73257743 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1026831645 7:73613902-73613924 TGAGGCGGGCAGATCATCTGAGG + Intronic
1026860316 7:73782688-73782710 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1026866469 7:73827140-73827162 CGAGGCGGGCAGATCATCTGAGG + Intronic
1027020627 7:74811134-74811156 GGAGGCGGGCAGATCACCTGAGG + Intronic
1027027992 7:74868367-74868389 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1027059758 7:75075704-75075726 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1027067398 7:75134797-75134819 GGAGGCGGGCAGATCACCTGAGG - Intronic
1027147393 7:75705585-75705607 TGAGGCGGGCAGATCATCTGAGG - Intronic
1028043050 7:86081527-86081549 GGAGGCGGGTGGATCATCTGAGG - Intergenic
1028385966 7:90253622-90253644 GGAGGCGGGTGGATCATCTGAGG - Intronic
1029628801 7:101737472-101737494 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1030075285 7:105731665-105731687 GGAGGCGGGCAGATCACCTGAGG - Intronic
1030369645 7:108684310-108684332 GGAGGCGGGCAGAACATCTGAGG - Intergenic
1030494055 7:110274591-110274613 CGAGGCGGGTAGATCATCTGAGG + Intergenic
1030689537 7:112518186-112518208 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1030851763 7:114495737-114495759 TGAGGCGGGCAGATCATCTGAGG - Intronic
1032021905 7:128411481-128411503 TGAGGCGGTCAGATCACCTGAGG + Intergenic
1033393711 7:140953480-140953502 CGAGGCGGGAAGATCATCTGAGG + Intergenic
1033402602 7:141040934-141040956 GGAGGCGGGTAGATCATTTGAGG - Intergenic
1034327143 7:150247026-150247048 CGAGGCGGGCAGATCATCTGAGG - Intronic
1036632915 8:10527978-10528000 CGAGGCGGGCAGATCATCTGAGG + Intronic
1037580646 8:20244252-20244274 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1037627194 8:20618533-20618555 TGAGGCGGGCAGATCACCTCAGG - Intergenic
1038451370 8:27641384-27641406 GGAGGGGGTGAGCTCATCTTTGG + Intronic
1038507924 8:28101820-28101842 TGAGGCGGGCAGATCACCTCAGG - Intronic
1039043229 8:33427343-33427365 CGAGGCGGGCAGATCATCTGAGG + Intronic
1039856909 8:41422879-41422901 GGAGGCGGGTAGATCATTTGAGG + Intergenic
1039898386 8:41732643-41732665 CGAGGAGGGGAGATCATCTGCGG - Intronic
1040684195 8:49851535-49851557 TGAGGCGGCCAGATCATCTGAGG + Intergenic
1040761313 8:50848941-50848963 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1042172539 8:66006024-66006046 GGAGGCAGTGAGATCATTCTGGG + Intergenic
1042345332 8:67720904-67720926 GGAAGAGGAGAGATCAACTCAGG - Intronic
1042447965 8:68910794-68910816 CGAGGCGGACAGATCATCTGAGG + Intergenic
1042510725 8:69608445-69608467 CGAGGCGGGCAGATCATCTGAGG + Intronic
1042521912 8:69721937-69721959 TGAGGCGGGCAGATCACCTCAGG + Intronic
1042887345 8:73567273-73567295 CGAGGCGGGCAGATCACCTCAGG + Intronic
1043603553 8:81971384-81971406 TGAGGAGGTGAGGTCATCCCTGG + Intergenic
1044039540 8:87349605-87349627 CGAGGCGGGCAGATCATCTGAGG - Intronic
1044520712 8:93196122-93196144 TGAGGCGGGTAGATCATCTGAGG - Intergenic
1044523445 8:93225400-93225422 GGAGGCGGGCGGATCATCTGAGG + Intergenic
1044740571 8:95322244-95322266 CGAGGCGGGCAGATCACCTCAGG - Intergenic
1045612944 8:103869553-103869575 TGAGGCGGGCAGATCATCTGAGG - Intronic
1045670902 8:104552435-104552457 CGAGGCGGGCAGATCATCTGAGG + Intronic
1046108765 8:109696197-109696219 CGAGGCGGGCAGATCATCTGAGG + Intergenic
1046943669 8:119955088-119955110 CGAGGTGGTTAGATCACCTCAGG - Intronic
1047421812 8:124713654-124713676 TGAGGCGGGCAGATCATCTGAGG - Intronic
1047424244 8:124730734-124730756 CGAGGCGGGTAGATCATCTGAGG - Intergenic
1047470013 8:125161563-125161585 TGAGGCGGTTGGATCATCTGAGG + Intronic
1047960460 8:130007974-130007996 CGAGGCGGCCAGATCATCTGAGG + Intronic
1048186033 8:132241599-132241621 CGAGGCGGGCAGATCATCTGAGG + Intronic
1049302114 8:141877018-141877040 GGAGGCGGGCAGATCACCTAAGG - Intergenic
1049601360 8:143509330-143509352 GAAGGTGGTGAGGTCACCTCGGG - Intronic
1049721625 8:144118692-144118714 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1049975602 9:858639-858661 CGAGGCGGGCAGATCATCTGAGG + Intronic
1050263331 9:3863902-3863924 GGAGGAGGGGAGAACGTCTCGGG + Intronic
1051078194 9:13265335-13265357 TGAGGCGGTCAGATCACCTGAGG + Intronic
1051643805 9:19248620-19248642 TGAGGCGGGCAGATCATCTGAGG - Intronic
1051697735 9:19788073-19788095 GCAGTCGCTGAGATAATCTCAGG + Intergenic
1051950550 9:22626359-22626381 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1052288895 9:26820069-26820091 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1052897503 9:33761472-33761494 GGAGGCGGGCAGATCATGTGAGG + Intronic
1053656162 9:40220028-40220050 CGAGGCGGGTAGATCATCTGAGG + Intergenic
1053843515 9:42211728-42211750 TGAGGCGGGCAGATCACCTCAGG + Intergenic
1054528454 9:66156266-66156288 CGAGGCGGGTAGATCATCTGAGG - Intergenic
1054585761 9:66964427-66964449 TGAGGCGGGCAGATCACCTCAGG - Intergenic
1054675888 9:67855996-67856018 CGAGGCGGGTAGATCATCTGAGG + Intergenic
1054861574 9:69959141-69959163 GGAGGCGGGCAGATCATTTGAGG - Intergenic
1055258313 9:74400189-74400211 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1055278978 9:74652172-74652194 CGAGGCGGGCAGATCATCTGAGG + Intronic
1055448245 9:76405049-76405071 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1056406978 9:86283780-86283802 CGAGGCGGGGAGATCACCTGAGG + Intergenic
1057148868 9:92778435-92778457 CGAGGCGGTCAGATCACCTGAGG - Intergenic
1057357728 9:94345657-94345679 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1057371129 9:94474246-94474268 CGAGGCGGGTGGATCATCTCAGG - Intergenic
1057416699 9:94870220-94870242 GGAGGCGGGCAGATCACCTGAGG - Intronic
1057497745 9:95574234-95574256 GGGGGCGGTGCCATCATCTGTGG - Intergenic
1057497787 9:95574396-95574418 GGGGGCGGTGCCATCATCTGTGG - Intergenic
1057497845 9:95574636-95574658 GGGGGCGGTGCCATCATCTGTGG - Intergenic
1057650023 9:96911965-96911987 CGAGGCGGGCAGATCATCTGAGG + Intronic
1058700679 9:107597689-107597711 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1059103559 9:111492220-111492242 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1059137870 9:111824301-111824323 GGAGGCGGGAAGATCACCTGAGG + Intergenic
1059623462 9:116034905-116034927 TGAGGCGGGCAGATCATCTGAGG - Intergenic
1059975968 9:119717638-119717660 AGAGGCAGTCAGATGATCTCTGG + Intergenic
1060161819 9:121370916-121370938 CGAGGCGGGTAGATCATCTGAGG + Intergenic
1060262131 9:122085025-122085047 TGAGGCGGGCAGATCATCTGAGG + Intronic
1060973922 9:127754167-127754189 GGAGGCGGTGAGATCATCTCTGG - Intronic
1060977793 9:127775395-127775417 TGAGGCGGGCAGATCATCTGAGG + Intronic
1061048851 9:128182371-128182393 CGAGGCGGGCAGATCATCTGAGG - Intronic
1061092871 9:128436478-128436500 TGAGGCGGGCAGATCACCTCAGG - Intronic
1061173264 9:128974991-128975013 GGAGGCAGTGGGATCACCTGAGG - Intronic
1061308618 9:129747775-129747797 CGAGGCGGACAGATCATCTGAGG + Intronic
1061391030 9:130317085-130317107 GGAGGGGGTGAGTGCAGCTCTGG + Intronic
1062155181 9:135044146-135044168 CGAGGCGGGTAGATCACCTCAGG - Intergenic
1062186866 9:135222986-135223008 GGGAGCGGTGAGATCATGTGCGG - Intergenic
1062656545 9:137606719-137606741 GGAGGCTGTGGGGTCATCCCAGG - Intronic
1187166223 X:16806547-16806569 TGAGGCGGGCAGATCATCTGAGG + Intronic
1187500899 X:19837671-19837693 CGAGGCGGGCAGATCATCTGAGG - Intronic
1187655669 X:21469676-21469698 CGAGGCGGGCAGATCATCTGAGG + Intronic
1188157186 X:26754772-26754794 CGAGGCGGGGAGAACATCTGAGG - Intergenic
1188191237 X:27173981-27174003 GGAGGCGGTCGGATCATCTGAGG + Intergenic
1188249131 X:27870455-27870477 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1189100006 X:38179176-38179198 CGAGGCGGGCAGATCATCTGAGG - Intronic
1189494205 X:41494502-41494524 CGAGGCGGTCAGATCACCTGAGG - Intergenic
1189985444 X:46549508-46549530 CGAGGCGGGCAGATCATGTCAGG + Intergenic
1190235650 X:48613300-48613322 TGAGGCGGGCAGATCACCTCAGG - Intergenic
1190242256 X:48666623-48666645 GGAGGGGGGCAGATCATCTGAGG - Intergenic
1190748994 X:53344865-53344887 CGAGGCGGGCAGATCACCTCAGG - Intergenic
1190880566 X:54489347-54489369 CGAGGCGGTTGGATCACCTCAGG + Intronic
1190891790 X:54575498-54575520 GGAGGCGGGCAGATCACCTGAGG + Intergenic
1191072545 X:56417630-56417652 TGAGGCGGGTAGATCATCTGAGG - Intergenic
1192357274 X:70416097-70416119 CGAGGCGGGCAGATCATCTGAGG - Intronic
1192465395 X:71351698-71351720 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1192471679 X:71404567-71404589 GGAGGCGGGCAGATCACCTGAGG - Intronic
1192472894 X:71414784-71414806 GGAGGCGGGCAGATCACCTGAGG + Intronic
1192575709 X:72241588-72241610 TGAGGCGGGCAGATCATCTGAGG + Intronic
1193677502 X:84474056-84474078 CGAGGCGGGCAGATCATCTGAGG + Intronic
1194640361 X:96396634-96396656 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1194725857 X:97396437-97396459 TGAGGCGGGCAGATCATCTGAGG + Intronic
1195584032 X:106542936-106542958 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1195993690 X:110709770-110709792 TGAGGCGGGTAGATCATCTGAGG + Intronic
1196212942 X:113015423-113015445 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1196436875 X:115682665-115682687 GGAGGCGGGCAGATCACCTGAGG - Intergenic
1196773228 X:119316562-119316584 CGAGGCGGGCAGATCATCTGAGG - Intergenic
1197191921 X:123656775-123656797 GGAGGTGGGTAGATCATCTAAGG + Intronic
1197248237 X:124188309-124188331 AGAGGCGGGCAGATCATCTGAGG - Intronic
1197854610 X:130902108-130902130 GGGGGTGGTGAGTTCATCTATGG - Intronic
1197908398 X:131451760-131451782 TGAGGCGGGTGGATCATCTCAGG - Intergenic
1198519410 X:137437584-137437606 AGAGGCGGGGGGATCATCTGAGG + Intergenic
1198640652 X:138752192-138752214 GGAGGCGGGCAGATCACCTGAGG + Intronic
1200130127 X:153837626-153837648 TGAGGCGGGCAGATCATCTGAGG + Intergenic
1200217585 X:154374824-154374846 GCCGGCGGTGAGCTCATCTCGGG - Intergenic